-
Plasmid#42196DepositorInsertβ-arrestin 1 S412D (Arrb1 Rat)
UseTagsFlagExpressionMammalianMutationS412DPromoterCMVAvailable sinceJan. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 βarr1 S412A Flag
Plasmid#42195DepositorInsertβ-arrestin 1 S412A (Arrb1 Rat)
UseTagsFlagExpressionMammalianMutationS412APromoterCMVAvailable sinceJan. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y357F-PolyA
Plasmid#112287PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y357F mutant _ corresponding to tyrosine 407 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationTyrosine 357 to Phenyalanine corresponding to tyr…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorInsertsh RNAi Diacylglycerol kinase zeta mouse (Dgkz Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorInsertsh RNAi Diacylglycerol kinase alfa human (DGKA Human)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cAbl
Plasmid#214234PurposeBacterial expression of the kinase domain of cAbl with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorInsertABL1 Kinase domain (ABL1 Human)
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR
Plasmid#28235PurposeMammalian expression of Androgen receptor fused to EGFPDepositorInsertAndrogen receptor (AR Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR V7
Plasmid#86856PurposeFluorescent human androgen-receptor splice variant 7, lacking the ligand-binding domain (fused to EGFP)DepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationAlternative splice variant 7 (alteration/deletion…PromoterCMVAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q48
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_5SA-PolyA
Plasmid#112285PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) 5SA active mutant - serines 61, 109, 127, 164 and 397 (also known as 381 in other isoforms)DepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with 5 Serines (61, 109, 127, 1…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q0
Plasmid#86427PurposeFluorescent human androgen receptor (fused to EGFP) with deleted polyglutamine regionDepositorInsertandrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationDeletion of the poly-glutamine expansionPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG_FBXL7
Plasmid#171848PurposepcDNA3-FLAG_FBXL7DepositorInsertF-box and leucine rich repeat protein 7 (FBXL7 Human)
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -