-
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyTagsExpressionBacterial and YeastMutationn/aPromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMB30
Plasmid#122247PurposeLentivirus delivery for stable expression of Lb crRNA, has LbDR; Cloning vector for expression of LbCas12a crRNA. It contains BsmBI site for cloning.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFTK086
Plasmid#171358PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertP-ANtRNA[Arg21]-sgRNA-dummy-Esp3I, Pol-III sgRNA-plug-in transcription unit
UseSynthetic BiologyTagsExpressionBacterial and YeastMutationn/aPromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW299-lenti-spsgRNA-Esp3I-2kb-filler-pEF1s-NLS-tagBFP-P2A-BlastR
Plasmid#189943PurposeLentiviral vector to co-express an spsgRNA with NLS-tagBFPDepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
UseTagsExpressionMammalianMutationPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
gGBEv6.3-SpCas9
Plasmid#202629Purposevector for encoding an engineered glycosylase-based guanine base editor (gGBEv6.3) with SpCas9 nickase driven by EF1a promoter, guide RNA compatible with SpCas9 driven by hU6, mCherry driven by CBh promoterDepositorInsertnSpCas9(D10A)-MPGv6.3
UseTagsExpressionMammalianMutationMPGv6.3 = G163R, N169G, D175R, C178N, S198A, K202…PromoterhU6, EF1a, CBhAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi
Plasmid#138106PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas12Max
Plasmid#195334Purposevector for encoding a human codon-optimized Cas12Max driven by CBh promoter, guide RNAs compatible with xCas12i driven by hU6, and mCherry driven by CMV promoterDepositorInserthuman codon-optimized Cas12Max
UseTags3xFlagExpressionMammalianMutationN243RPromoterCBh, CMV, hU6Available sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
gGBEv6.3-SpG
Plasmid#202630Purposevector for encoding an engineered glycosylase-based guanine base editor (gGBEv6.3) with SpG nickase driven by EF1a promoter, guide RNA compatible with SpG driven by hU6, mCherry driven by CBh promoterDepositorInsertnSpG(D10A)-MPGv6.3
UseTagsExpressionMammalianMutationSpG = D1135L, S1136W, G1218K, E1219Q, R1335Q, T13…PromoterhU6, EF1a, CBhAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-STU-Lb
Plasmid#138096PurposeGolden Gate entry vector for 1st crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-STU-Lb
Plasmid#138105PurposeGolden Gate entry vector for 4th crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-STU-Lb
Plasmid#138102PurposeGolden Gate entry vector for 3rd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-STU-Lb
Plasmid#138099PurposeGolden Gate entry vector for 2nd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-pT
Plasmid#138108PurposeGolden Gate recipient and Gateway entry vector; assembly of 4 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-xF2X-P2A-Puro
Plasmid#110873PurposeLentiviral vector for constitutive expression of xFNLS in mammalian cells (codon optimized)DepositorInsertxFNLS-2X(3.7)
UseLentiviralTags3X FLAGExpressionMutationD10A, A262T, R324L, S409I, E480K, E543D, M694I, E…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-SPdCas9-EGFP-2A-Blast
Plasmid#71215PurposedCas9 fused to EGFPDepositorInsertdSpCas9-EGFP
UseLentiviralTagsdSpCas9-EGFPExpressionMammalianMutationPromoterAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
xCas12i
Plasmid#195333Purposevector for encoding a human codon-optimized xCas12i driven by CBh promoter, guide RNAs compatible with xCas12i driven by hU6, and mCherry driven by CMV promoterDepositorInserthuman codon-optimized xCas12i
UseTags3xFlagExpressionMammalianMutationPromoterCBh, CMV, hU6Available sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDYT001
Plasmid#186549PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)DepositorInsert14-bp random integration barcode and three target sites and 3x sgRNAs
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterEF1alphaAvailable sinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only