-
Plasmid#187599PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
UseTagsExpressionBacterialMutationPromotertrcAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF (VE5596)
Plasmid#139768PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette.DepositorTypeEmpty backboneUseTagsExpressionMutationPromoterPH or p10Available sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL
Plasmid#65713PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL)DepositorInsert7xTcf, minCMV, 3xNLS, ONL
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV loxP L5-L2
Plasmid#62094PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and multiple cloning site flanked by loxP sites. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCre/Lox; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pME-3xNLS-(G2SG2)2-Cre (JDW 1149)
Plasmid#224514PurposeA Gateway compatible middle entry clone containing a 3x nuclear localization signal followed by a multiple cloning site and a flexible linker fused to CreDepositorInsert3xNLS-(G2SG2)2-Cre
UseCre/LoxTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-PSMB5-PSMB6-PSMB7
Plasmid#217898PurposeInsect cell expression of human 20S CP proteasome subunit beta type-5 (PSMB5), beta type-6 (PSMB6), and beta type-7 (PSMB7)DepositorUseTagsExpressionInsectMutationPromoterAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-Lag16-fibcon-iCAM1-tether
Plasmid#205213PurposeThis vector encodes of the synCAM tether (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 Tether and Lag16 anti-GFP nanobody
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
Plasmid#186413PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined NLSLacZ under control of an AttB3/B5 recombined reg. sequence.DepositorInsertlacZ (lacZ E. coli)
UseGateway destination vectorTagsNuclear localization signalExpressionMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-AVI-Tfap2B-tev-FLAG-2A-Citrine
Plasmid#127776PurposeModified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Tfap2B in frame with an Avi tag at the N terminus and FLAG-tag and Citrine at the C-terminusDepositorInserttfap2b (TFAP2B Chicken)
UseUnspecifiedTagsAviExpressionMutationPromoterAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3_mTq-Tat (c-plasmid)
Plasmid#127635PurposeEncodes a fluorecent protein with an RNA binding peptide: mTurquoise2-tat.Expression with constitutive E. coli RNAP promoter (J23106), ribozyme PlmJ and RBS BBa_B0034.DepositorInsertmTurquoise2
UseSynthetic BiologyTagsRNA binding peptide: PCP and RNA binding peptide:…ExpressionBacterialMutationPromoterAvailable sinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-CeNL(Ca2+)_19μ-pcDNA3
Plasmid#111923PurposeCyan color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of CeNL(Ca2+)_19μDepositorInsertCeNL(Ca2+)_19μ
UseTagsCoxVIIIx2ExpressionMammalianMutationE67D, F92W, E104D, D133E at CaMPromoterCMVAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-CeNL(Ca2+)_1.2μ-pcDNA3
Plasmid#111922PurposeCyan color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of CeNL(Ca2+)_1.2μDepositorInsertCeNL(Ca2+)_1.2μ
UseTagsCoxVIIIx2ExpressionMammalianMutationE67D, E104D, D133E at CaMPromoterCMVAvailable sinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pG3H-PE3max-attR1R2
Plasmid#213049PurposeDestination vector Expressing nCas9 and RT fusion protein and carrying Gateway recombination sitesDepositorInsertsCas9 nickase
M-MLV Reverse Transcriptase
UseNote: this plasmid needs helper pvs1-vir2 for rep…TagsExpressionPlantMutationH840A, R240K, N413K,PromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 Hepatitis C Virus NS3/NS4A
Plasmid#61696Purposeinducible dual expression of NS3 protease along with its cofactor NS4ADepositorInsertsNS4A
NS3
UseTagshisExpressionBacterialMutationPromoterT7Available sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
RGB-S reporter
Plasmid#207841PurposeA three-colour stress biosensor for real time analysis of physiological stress, genotoxicity, and cytotoxicity of Escherichia coliDepositorInsertsRpoH sensing construct
SOS sensing construct
RpoS sensing construct
UseTagsExpressionBacterialMutationPromoterPosmY, PsulA, and grpEAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2AExpressionMutationPromoterEFSAvailable sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1_EF1a-GEM2-Halo-FKBP-IRES-Blast
Plasmid#197066PurposeDonor plasmid for human AAVS1 locus knock-in, constitutive expression of GEM2-Halo-FKBPDepositorInsertEncapsulin
UseCRISPRTagsFKBP and HaloTagExpressionMammalianMutationCodon-optimised for human cell expressionPromoterAvailable sinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2AExpressionMutationPromoterEFSAvailable sinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianMutationPromoterU6Available sinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only