-
Plasmid#51814PurposeP2A peptide from porcine teschovirus-1 flanked by restriction sites in shuttle vector for easy cloning of multiple separate proteins to be expressed from single messageDepositorInsertP2A peptide (PTV1gp1 Synthetic, porcine teschovirus-1)
UseShuttle vector for insect expression vectorsTagsExpressionMutationcodons altered for Drosophila and to eliminate re…PromoterAvailable sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
Tol2-CAG::Cytbow
Plasmid#158991PurposeMulticolor cytoplasmic cell labeling with a genome-integrating Tol2 transposon vector (randomly expressing 3 tdTomato, mCerulean or mEYFP upon Cre recombination)DepositorInsertCytbow
UseTagsThe default expressed EBFP2 is fused to H2BExpressionMammalianMutationPromoterCAGAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMBEC2
Plasmid#187596PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Kanamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
UseTagsExpressionBacterialMutationPromotertrcAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FoxJ1 promoter-IRES-EGFP-Flag-hChibby1
Plasmid#122964PurposeExpresses Flag-tagged Chibby1 in multiciliated cells under FoxJ1 promoter. It can be used as a cloning vector for gene of interest at SfiI sites.DepositorInserthuman Chibby1 (CBY1 Human)
UseLentiviralTagsFlagExpressionMutationPromoterFoxJ1 and human FoxJ1Available sinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10713
Plasmid#183958PurposeU6-crSox2-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Sox2
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE2_pLVX-EF1a-NBio-dCas9-IRES-zsGreen1
Plasmid#138419PurposeCAPTURE2.0 vector containing NBio-dCas9, IRES and zsGreen1DepositorInsertdCas9
UseLentiviralTagsBioTAP-tagExpressionMutationPromoterEF1aAvailable sinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p221z-erVenusYFP
Plasmid#71265PurposeEntry clone containing ER-localized Venus. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTagsER retention signal HDEL and signal peptide (ER)…ExpressionMutationPromoterAvailable sinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETduet-1:MCS1(HemeOxygenase)::MCS2(ReBphP-PCM)
Plasmid#156463PurposeExpress Heme Oxygenase (Nostocaceae) and ReBphP-PCMDepositorInsertsHeme Oxygenase
ReBphP-PCM
UseTagsHis TagExpressionBacterialMutationPromoterT7Available sinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY095
Plasmid#84744PurposeExpresses huLbCpf1-T2A-GFP and crRNA guideDepositorInsertshuLbCpf1
GFP
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p221z-erTagRFP
Plasmid#71266PurposeEntry clone containing ER-localized TagRFP. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGatewayTagsER retention signal HDEL and signal peptide (ER)…ExpressionMutationPromoterAvailable sinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY31
Plasmid#84746PurposeExpresses huLbCpf1-P2A-puro and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianMutationPromoterCMVAvailable sinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDRf1-4CL5-AtSCT (JBEI-11557)
Plasmid#87937PurposeCo-expression in S.cerevisiae of 4CL5 and AtSCTDepositorInsertsUseTagsExpressionYeastMutationPromoterAvailable sinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
p221k-erTq2CFP
Plasmid#71264PurposeEntry clone containing ER-localized Turqoise2. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway system.DepositorInsertTq2CFP
UseGatewayTagsER retention signal HDEL and signal peptide (ER)…ExpressionMutationPromoterAvailable sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC5-dual-dCas9VP48-sgTetO
Plasmid#48237PurposeDual expression construct expressing both dCas9VP48 and sgTetO from separate promotersDepositorInsertdCas9VP48 and sgTetO
UseCRISPRTagsHA-tag and VP48ExpressionMammalianMutationD10A H840A (catalytically inactive)PromoterAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10714
Plasmid#183959PurposeU6-crKlf4-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Klf4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-Sox10-FLAG-tev-AVI
Plasmid#127775PurposeModified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Sox10 in frame with a Flag-tag and Avi-tagDepositorInsertsox10 (SOX10 Chicken)
UseEnhancer reporter constructTagsAviExpressionMutationPromoterAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Carl-CeNL(Ca2+)_110μ-KDEL-pcDNA3
Plasmid#111925PurposeCyan color luminescent Ca2+ indicator targeted to endoplasmic reticulum. Calreticulin and a KDEL signal for ER retention located at the N-terminus and C-terminus of CeNL(Ca2+)_110μDepositorInsertCeNL(Ca2+)_110μ
UseTagsCalreticulin and KDELExpressionMammalianMutationE31D, F92W, E104D. D133E at CaMPromoterCMVAvailable sinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-OeNL(Ca2+)_18μ-pcDNA3
Plasmid#111924PurposeOrange color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of OeNL(Ca2+)_18μDepositorInsertOeNL(Ca2+)_18μ
UseTagsCoxVIIIx2ExpressionMammalianMutationE67D, E104D, D133E at CaMPromoterCMVAvailable sinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-CNL
Plasmid#65712PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-CNL)DepositorInsert7xTcf, minCMV, 3xNLS, CNL
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only