-
Plasmid#213071PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.5 with with furin side intactDepositorInsertpαH-S-RRAR-OMICRON.BA.5 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685, furin site inta…PromoterAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/EG.5
Plasmid#212990PurposeMammalian cell expression of SARS-CoV-2 Spike protein of OMICRON.EG5 variantDepositorInsertpαH-S-GSAS/EG.5 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterCMVAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV2 NSP7/bat-CoV RaTG13 C-V5-tag
Plasmid#179974PurposeMammalian expression vector for SARS-CoV-2 Nsp7 or bat RaTG13 Nsp7, V5-tagged (SARS-CoV-2 Nsp7 and RaTG13 Nsp7 have the same amino acid sequence and codon optimized sequence).DepositorInsertSARS-CoV-2 Nsp7 (ORF1ab Synthetic)
UseTagsExpressionMammalianMutationhuman codon-optimizedPromoterAvailable sinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475RG502R-AVI
Plasmid#160480PurposeExpresses SARS-CoV-2 RBD-L455RA475RG502R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475RG502R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine, Alanine 475 to A…PromoterAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RG496R-AVI
Plasmid#160479PurposeExpresses SARS-CoV-2 RBD-L455RG496R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RG496R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Glyci…PromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475R-AVI
Plasmid#160478PurposeExpresses SARS-CoV-2 RBD-L455RA475R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Alani…PromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-FLAG (dark) WPRE
Plasmid#131005PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-FLAG, a cytoplasmic fluorescent protein which includes multiple FLAG epitope tagsDepositorInsertsmFP-FLAG WPRE
UseMosaic analysis for dual recombinase-mediated cas…TagsFLAG - 10 total FLAG tagsExpressionMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available sinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-K27M-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131462PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A K27M, PDGFRA D842V, and TRP53DepositorInsertH3F3A-K27M-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationH3F3A K27M, Pdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available sinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-G34R-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131463PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A G34R, PDGFRA D842V, and TRP53DepositorInsertH3F3A-G34R-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationH3F3A G34R, Pdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available sinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131461PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of WT H3F3A and oncogenic PDGFRA D842V and TRP53DepositorInsertH3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationPdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available sinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor TagBFP2-V5-HRAS G12VWPRE
Plasmid#129420PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic Hras G12V with a TagBFP2 fusionDepositorInsertTagBFP2-V5-HRAS G12V (HRAS Human, Entacmaea quadricolor (TagBFP))
UseMosaic analysis for dual recombinase-mediated cas…TagsTagBFP2-V5 tagExpressionMutationG12VPromoternone (3x polyA to mitigate episomal expression)Available sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR/XBB.1.5
Plasmid#212993PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.5 with with furin side intactDepositorInsertSpike S-RRAR/XBB.1.5 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); furin site intake; (T19I…PromoterCMVAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FGFR1-COMP5AP-AviTag-9xHis
Plasmid#157364PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFGFR1 (FGFR1 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FGFR2-COMP5AP-AviTag-9xHis
Plasmid#157365PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFGFR2 (FGFR2 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor TagBFP2-V5-HRAS G12V WPRE RCE
Plasmid#131730PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic Hras G12V with a TagBFP2 fusion compatible with RCE:loxP mouse strainDepositorInsertTagBFP2-V5-HRAS G12V (HRAS Human, Entacmaea quadricolor (TagBFP))
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTagBFP2-V5 tagExpressionMammalianMutationG12VPromoternone (4x polyA to mitigate episomal expression)Available sinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V1 (Concentrated Lentiviral Prep)
Viral Prep#115643-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V1 (#115643). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V1 plasmid DNA. <p><p>Ready-to-use lentiviral particles carrying version 1 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.</p></p>DepositorPromoterMinimal CMVTagsEGFPAvailable sinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V3 (Concentrated Lentiviral Prep)
Viral Prep#115645-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V3 (#115645). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V3 plasmid DNA. Ready-to-use lentiviral particles carrying version 3 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.DepositorPromoterMinimal CMVTagsEGFPAvailable sinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMAL-CellTag-V2 (Concentrated Lentiviral Prep)
Viral Prep#115644-LVCPurposeReady-to-use Concentrated Lentiviral Prep particles produced from pSMAL-CellTag-V2 (#115644). In addition to the viral particles, you will also receive purified pSMAL-CellTag-V2 plasmid DNA. Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding library to combinatorially index cells for single-cell analysis of clonal dynamics.DepositorPromoterMinimal CMVTagsEGFPAvailable sinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only