-
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
UseTagsExpressionMammalianMutationPromoterPhCMVAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EBFP_Nick_Dual_sgRNA
Plasmid#178094PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and EBFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EBFP nick sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EGFP_Nick_Dual_sgRNA
Plasmid#178095PurposeControl vector for coselection for PE3b in human cells. Tandem expression of ATP1A1 G3 and EGFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EGFP nick sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178096PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
Plasmid#178102PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA
Plasmid#178108PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_F2108L_Dual_pegRNA
Plasmid#178109PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_E2419K_Dual_pegRNA
Plasmid#173209PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR E2419K pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG422_UV5
Plasmid#165607PurposeVector for expression of the SpCas9 KG variant with sgRNA in E. coli: KG(SpCas9, D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 KG(D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationD1332K and R1333G mutations in SpCas9PromoterlacUV5 driving Cas9 KG and UV5 driving sgRNAAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-GW-A
Plasmid#138480PurposeFor expression of ribozyme-flanked sgRNA after the Gateway (GW) LR cloning.DepositorInsertGateway attR1/R2 cassette with chloramphenicol resistance and ccdB genes
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(BsmBI)-EF1a-BFP-BSD-Dmap1(SDM)
Plasmid#117139PurposeExpression vector encoding BFP-BSD-HA-Dmap1 resistant against gRNA encoded by pKLV2-U6(gDmap1 v4)--PGK-Puro-BFPDepositorInsertHA-Dmap1 (mutagenised) (Dmap1 Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationmodified BFP, modified Dmap1 CDSPromoterhuman U6 promoter, human EF1a promoterAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHIV(T9)-DERA-sgresis
Plasmid#222622PurposeLentiviral vector that expresses sgRNA resistant DERA in mammalian cellsDepositorInsertDERA (DERA Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-nSpCas9-NoCBE
Plasmid#209038PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized SpCas9(D10A)-6xNLS (Cas9 nickase) linked to ssDNA binding domain from RAD51 and uracil DNA glycosylase inhibitor (UGI)DepositorInsertnSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-APOBEC1
Plasmid#209039PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized cytosine base editor where APOBEC1 is fused to the N-terminus of SpCas9(D10A)-sDNA Rad51-2xUGI-6xNLSDepositorInsertAPOBEC1-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only