-
Plasmid#124049PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to KRAB domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::KRAB-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCDNA5-LAP-MPS1-dTPR
Plasmid#114048PurposeExpression of exogenous LAP tagged MPS1 delta TPR (TPR is deleted)DepositorInsertMPS1-dTPR (TTK Human)
UseTagsExpressionMammalianMutationdelta TPR (deletion of TPR domain 63-191)PromoterAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-LAP-MPS1-d200
Plasmid#114047PurposeExpression of exogenous LAP tagged MPS1 delta 200 (NTE and TPR are deleted)DepositorInsertMPS1-d200 (TTK Human)
UseTagsExpressionMammalianMutationdelta 200 (deletion of NTE and TPR domains)PromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-LAP-MPS1-d60
Plasmid#114046PurposeExpression of exogenous LAP tagged MPS1 delta 60 (NTE is deleted)DepositorInsertMPS1-d60 (TTK Human)
UseTagsExpressionMammalianMutationdelta 60 (deletion of NTE domain)PromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS424-TUB2 - human TUBB3 Cterminal tail delta K
Plasmid#60404PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta3 tubulin Cterminal tail (TUBB3) without last 4 amino acids--QGPKDepositorInsertTUB2
UseTagsExpressionYeastMutationTUB2 amino acids 429 - end, replaced with human T…PromoterGALAvailable sinceMay 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EngPDm
Plasmid#64040PurposeMammalian expression of mutant paired domain of Pax8 fused to the N-terminal repressor domain of the drosophila engrailed protein (Eng)DepositorInsertPax8 paired domain (Pax8 Mouse)
UseTagsEng (N-terminal repressor domain of the drosophi…ExpressionMammalianMutationpaired domain, aa 1-147, with aa 30 to 32 changed…PromoterCMVAvailable sinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT_PCaspase_PCi_PC-σ
Plasmid#214040PurposeBacterial expression plasmid for SAVED-CHAT, PCaspase, PCi, and PC-σ from Haliangium ochraceumDepositorInsertSAVED-CHAT-Pcaspase-Pci-PC-σ
UseTagsExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc1/bC
Plasmid#74049Purposeretroviral expression plasmid for human NFATc1/bCDepositorInserthuman NFATc1, isoform beta-C (NFATC1 Human)
UseRetroviralTagsno tagExpressionMammalianMutationPromoterpMSCV-LTRsAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
HTR1A-Tango
Plasmid#66404PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorInsertHTR1A (HTR1A Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pH-nCas9-PPE
Plasmid#140447PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9(H840A)-M-MLV
UseCRISPRTagsExpressionPlantMutationH840A for Cas9; D200N, T306K, W313F, T330P and L…Promotermaize Ubiquitin-1, OsU3Available sinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cav3P104L-YFP
Plasmid#68404PurposeExpression of fluorescently tagged Caveolin3 point mutation in mammalian cellsDepositorInsertCav3 (Cav3 Mouse)
UseTagsEYFPExpressionMammalianMutationProline at position 104 changed to a LeucinePromoterCMVAvailable sinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
ANGPT-bio-His
Plasmid#53404PurposeExpresses full-length Angiopoietin-1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertANGPT (ANGPT1 Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
3019_pETcon-SARS-CoV-2-RBD_E484K
Plasmid#184404Purposeyeast surface display of the SARS-CoV-2 Eta variant RBDDepositorInsertSARS-CoV-2 Eta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
UseTagsHA and c-MycExpressionYeastMutationE484KPromoterAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:EDLL:tNos (GB1190)
Plasmid#75404PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the EDLL Transcriptional ActivatorDepositorInsertdCas:EDLL
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N391* full-length
Plasmid#221404PurposeMammalian expression of human integrin beta1 N391* full-lengthDepositorInsertintegrin beta1 N391* full-length (ITGB1 Human)
UseTagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequencePromoterAvailable sinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPCaspase
Plasmid#214042PurposeBacterial expression plasmid for PCaspase from Haliangium ochraceumDepositorInsertPCaspase
UseTagsExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT_PCaspase
Plasmid#214043PurposeBacterial expression plasmid for SAVED-CHAT and PCaspase N-terminal fragment (aa 1-153) from Haliangium ochraceumDepositorInsertSAVED-CHAT
UseTagsExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT_PCaspase-N-term
Plasmid#214044PurposeBacterial expression plasmid for SAVED-CHAT and PCaspase N-terminal fragment (aa 1-153) from Haliangium ochraceumDepositorInsertSAVED-CHAT-PCaspase
UseTagsExpressionBacterialMutationaa 1-153PromoterlacUV5 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only