Skip to main content
Addgene
  • Protocols
  • ddPCR Titration of Lentivirus Vectors

ddPCR Titration of Lentivirus Vectors

You may also like...

Introduction

This protocol describes how to use droplet digital PCR (ddPCR) to titer lentivirus vectors. This protocol specifically uses primers and probes targeting integrated copies of the Rev response element (RRE) in the target cells but can be modified for other targets. Primers and a probe against the cellular ribonuclease P/MRP 30 kDa subunit (RPP30) are used as a control for normalization. The dilution series outlined in this protocol is based on an LV titer range of 1E+05–1E+09 TU/mL, where TU is transducing units and generally represents the number of infectious viral particles. Users may need to run lower or higher dilutions depending on their particular sample.

This protocol was modified from the publication Wang et al. (2018) .

Before Starting

  • Thaw the master mix, primers/probe mixes and samples on ice before use.
  • Wipe down all pipettes and surfaces with 10% bleach.

Safety Warnings

Lentivirus is generally considered biosafety level 2+. Please ensure that you are in compliance with your institution’s biosafety regulations.

Last Update: July 7, 2023

Workflow Timeline

Day 1:
Seed and transduce cells
Day 4:
Treat cells with Benzonase and harvest cells
Day 4+:
ddPCR and analysis

Equipment

  • Class II, Type A2 Biological Safety Cabinet
  • Aspirating unit
  • Microcentrifuge, Eppendorf, 5425R
  • Droplet digital PCR System, Bio-Rad, DX200
  • Thermal Cycler, Bio-Rad, T100
  • PCR Plate Sealer, Bio-Rad, PX1
  • 1–10 µL single channel pipette
  • 20–200 µL single channel pipette
  • 200–1000 µL single channel pipette
  • 2–50 µL multichannel pipette
  • 20–200 µL multichannel pipette
  • Ice bucket
  • 96-well freezer blocks
  • Vortex, VWR, 10153-688
  • Mini Centrifuge, Thermo Scientific, 10199-452

Reagents

  • GeneJet Genomic DNA Purification Kit, Thermo Fisher, K0721
  • 6-well tissue culture treated dish, VWR, 29442-042
  • DMEM, high glucose, pyruvate, Corning, 10-013-CV
  • Heat-inactivated FBS
  • L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI)
  • 1X PBS pH 7.4 without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells)
  • Trypsin EDTA (TrypLE, Thermo Fisher, 12605010)
  • Ethanol, VWR, EX0276-1
  • Benzonase 250 U/µl, Millipore #71205-3
  • Polybrene 10 mg/mL, Millipore, TR-1003-G
  • Molecular Biology Grade Water, Hyclone, SH30538.02
  • ddPCR Supermix for Probes no dUTP, Bio-Rad,1863023
  • Droplet generation oil, Bio-Rad, 1863005
  • DG8 cartridge, Bio-Rad, 1864008
  • DG8 gasket, Bio-Rad, 1863009
  • DG8 cartridge holder, Bio-Rad, 1863051
  • 8-strip PCR tubes, Axygen, PCR-02-FCP-C
  • ddPCR 96-well PCR plates, Bio-Rad, 12001925
  • Pierceable foil heat seal, Bio-Rad, 1814040
  • Polystyrene reservoirs, VWR, 89094-662
  • Microcentrifuge tubes, VWR, 87003-294
  • Primers/probe targeting RRE:
    • forward primer: tgtgccttggaatgctagt
    • probe (FAM): tttggaatcacacgacct
    • reverse primer: aatttctctgtcccactccatc
  • PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244

Reagent Preparation

  • DMEM Complete:
    • 500 mL DMEM, high glucose, pyruvate
    • 55 mL heat inactivated premium grade, fetal bovine serum
    • 5 mL glutaGRO
  • 50 U/mL benzonase:
    • 15 mL DMEM Complete
    • 3 µL of 250 U/µL benzonase

Procedure

Transducing Cells

  1. Thaw the virus on ice.
  2. Prepare the following dilution series of virus in DMEM complete:
    • Prepare 7 microcentrifuge tubes with the appropriate amount of media volume listed in the chart below.
    • For the first virus dilution, add 160 µL of viral stock to 240 µL of media.
      • When adding the virus to the diluent, pipette 10 times, to remove virus from pipette tip.
      • To mix the dilution, set the P200 pipette to 200 µL and pipette 10–20 times.
    • Use a new pipette tip to transfer 200 µL of the first dilution into the next dilution.
    • Repeat for all dilutions as indicated in the chart below.
    Dilution Factor Virus Volume to Dilute Media Volume Total Volume
    2.5 160 µL viral stock 240 µL 400 µL
    5 200 µL of 2.5-fold dilution 200 µL 400 µL
    10 200 µL of 5-fold dilution 200 µL 400 µL
    20 200 µL of 10-fold dilution 200 µL 400 µL
    40 200 µL of 20-fold dilution 200 µL 400 µL
    80 200 µL of 40-fold dilution 200 µL 400 µL
    160 200 µL of 80-fold dilution 200 µL 400 µL
  3. Add 150 µL of each viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced (add 150 µL of DMEM complete instead of a viral dilution).
    • Remember, this is an additional 10-fold dilution of the virus stock! Don’t forget to factor this into your calculations later (see calculation example below).
  4. Seed 300,000 cells/well in 1350 µL media and 11.1 µg/mL Polybrene into the wells containing the virus and the untransduced control.
    Pro-Tip
    For even seeding, prepare a batch for 10 wells with 3,000,000 cells in 13.5 mL of media and 11.1 µg/mL Polybrene. Mix the cell suspension well before seeding.
  5. Mix each well with a 1 mL pipette 5–10 times.
    • The final volume in the well is 1.5 mL, and the final Polybrene concentration is 10 µg/mL.
  6. Mix well and incubate 72 h.

Benzonase Digestion and Cell Harvest

  1. Gently aspirate media from the 6-well plates. Be sure to use a new aspirating pipette for each well as to not contaminate cell conditions with others.
  2. Gently add 1.5 mL of 50 U/mL Benzonase in DMEM complete to each well.
  3. Incubate at 37 °C for 30 min.
  4. Gently aspirate media from wells, using a new aspirating pipette for each well.
  5. Wash wells with 1 mL of 1X PBS and aspirate, using a new aspirating pipette for each well.
  6. Detach cells by incubating with 200 µL TrypLE for 1–2 min.
  7. Resuspend cells in 500 µL DMEM complete and transfer to a microcentrifuge tube.
  8. Centrifuge for 5 min at 100 x g.
  9. Gently aspirate supernatant.
  10. Wash cell pellets in 500 µL PBS.
  11. Centrifuge for 5 min at 100 x g.
  12. Gently aspirate supernatant.
  13. Extract genomic DNA according to the GeneJet Genomic DNA Purification Kit instructions.
  14. Determine the concentration of each sample on a spectrophotometer.
  15. Prepare 25 ng/µL stocks of each sample. Samples can be used for ddPCR immediately or stored at -20 °C until ready to use.

Preparing for ddPCR

  1. Thaw samples, primers/probe mixes, and master mix on ice.
  2. Before handling any virus dilutions, get materials ready.
  3. Vortex primers/probe mixes and master mix for 15 sec then spin 10 sec in a mini centrifuge and place on ice.
  4. Wipe down a DG8 cartridge holder with bleach and place it in the Biological Safety Cabinet (BSC).
  5. Make sure that the BSC is supplied with sufficient pipette tips.
  6. Pre-warm the 96-well plate sealer by gently touching the screen.

Preparation of the Master Mix

  1. Place a ddPCR plate onto a chilled 96-well freezer block and set aside in the BSC to cool.
  2. Prepare the RRE/RPP30 master mix in a microcentrifuge tube as shown below. For 8 samples prepare enough master mix for 9 samples.
    Component Volume 9X Volume Final Concentrations
    2X ddPCR Supermix for Probes, no dUTP 10 µL 90 µL 1X
    20X RRE target primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM
    20X RPP30 primers/probe (HEX/VIC) 1 µL 9 µL 900 nM, 250 nM
    Nuclease-free water 4 µL 36 µL
    Total Volume 16 µL 144 µL
  3. Vortex the master mix for 15 sec and spin in a mini centrifuge for 10 sec before use.
  4. Place an 8-well PCR tube strip into a chilled 96-well freezer block.
  5. Add 16 µL of the master mix to each PCR tube. Be careful to dispense to the bottom of the tube without collecting drops along the side of the tube.
  6. Add 4 µL of the 25 ng/µL samples to the appropriate PCR tubes. Pipette back and forth 10 times to mix.

Generating the Droplets

  1. Place a DG8 cartridge into the cartridge holder.
  2. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction mixtures into the middle wells of the cartridge.
  3. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir.
  4. Using the 20–200 µL multichannel pipet, load 70 µL of droplet generation oil into the bottom row of wells.
  5. Cover the cartridge with the DG8 gasket, making sure that it is secure.
  6. Transfer the cartridge holder to the droplet generator. Close the lid and wait for the droplets to be generated.
  7. Once the droplets have been generated, use a 20–200 µL multichannel pipette to collect 40 µL of droplets.
    Pro-Tip
    To ensure that the droplets are not disrupted, insert the pipette tips directly in the center of the well and tilt to a 45° angle. Count to 20 while slowly and gently pipetting the droplets.
  8. Transfer the droplets to a prechilled PCR plate.
    Pro-Tip
    To ensure that the droplets are not disrupted, insert the pipette tips and gently touch the bottom of the well. Lift the tips ~1mm. Touch the side of the well and tilt the pipette tips at a 45° angle. Count to 20 while slowly and gently dispensing the droplets down the side of the tube.
  9. Place a Pierceable Foil Heat Seal on the PCR plate with the red line facing up. If the plate sealer is not at temperature, touch the screen on the plate sealer to allow it to get to temperature. Once the temperature is reached, place the PCR plate with the foil onto the metal support block. Place the block in the plate sealer and press the ‘Seal’ button.
  10. After the plate has been sealed, proceed to thermocycling.

Thermal Cycling

  1. Run the following PCR parameters:
    Cycling Step Temperature (°C) Time (min) Ramp Rate (°C/sec) # Cycles
    Enzyme Activation 95 10 2 1
    Denaturation 94 0.5 2 40
    Annealing/Extension 60 1 2 40
    Enzyme Deactivation 98 10 2 1
    Hold 4 ∞ 2 1
  2. After PCR is complete, transfer the plate to the Droplet Reader.
  3. Open the QuantaSoft software to set up a new plate layout. Designate the sample name, experiment type, supermix type (ddPCR Supermix for Probes), the target names and target types.
  4. When the plate layout is complete, select 'Run' to begin the droplet reading.
  5. When the droplet reading is complete, export the data from all wells as a CSV file which will be used to calculate the titer.

Calculations

  1. In the experimental setup above, the following virus dilutions were used to transduce cells:
    Initial dilution factor of virus stock Dilution factor after additional 10-fold dilution into 6-well plate
    2.5 25
    5 50
    10 100
    20 200
    40 400
    80 800
    160 1600
  2. To calculate the titers, first calculate the number of viruses per cellular genome:
    • Since the cellular gene RPP30 is used as a reference to the cellular genome, it is assumed that there are two copies of RPP30 in diploid cells, thus the reason for multiplying by 2.
    $$V = 2*{copies\ RRE \over copies\ RPP30}$$
  3. Use the viruses/genome to calculate the infectious titer:
    $$T = {V*C*D\over v}$$

    Where:

    • T = Infectious titer, TU/mL
    • V = Viruses per genome
    • C = # Cells per well
    • D = Dilution factor
    • v = Virus volume, mL
    *In the experimental setup above, the cells per well is 300,000 and the virus volume refers to the total volume the cells were transduced, which is 1.5 mL per well.
  4. Take the average infectious titer obtained from the appropriate dilutions to calculate the final infectious titer.

Tips and Troubleshooting

  • We recommend wiping down all pipettes and equipment with 10% bleach prior to use and keeping all reagents and samples on ice or pre-chilled 96-well freezer blocks during use.
  • To reduce the risk of contaminating reagents we recommend making small aliquots of master mixes, and primers/probe mixes prior to use.

Sample Data

  • When analyzing data there should be a clear distinction between negative droplets (black) and positive droplets (blue/green).
  • The concentration of RRE positive droplets in the untransduced control should be close to zero (A01).
  • In this protocol, the lentiviral particles are serially diluted and used to transduce HEK293T cells. Genomic DNA is extracted from the target cells and assayed for integrated copies of RRE. Since the samples that are assayed are diluted 2-fold serially, the concentration of RRE positive droplets should decrease by a factor of 2 across the dilutions. RPP30 copies should be relatively constant across samples.
    • In the RRE example below, 2-fold serial dilutions of a sample were loaded in wells B01-H01. As shown in the image (Figure 1) and table below, the concentration of RRE positive droplets increases by a factor of ~2 as you progress from the higher dilutions to the lower dilutions (blue).
    • As shown in the image (Figure 2) below, the concentration of RPP30 positive droplets stays relatively even across samples (green).
  • To increase the accuracy of the titer, calculate an average of several dilutions.
ddPCR results, RRE positive (blue) and negative (black) droplets
Figure 1: ddPCR Lentivirus sample data, RRE positive (blue) and negative (black) droplets
ddPCR results, RPP30 positive (green) and negative (black) droplets
Figure 2: ddPCR Lentivirus sample data, RPP30 positive (green) and negative (black) droplets
Sample ID Plasmid ID Dilution Copies/20 µL RRE (FAM) Copies/20 µL RPP30 (HEX) Viruses/genome Infectious titer (TU/mL) Average
1 800 428 22020 0.03887375114 6.22E+06
2 400 768 18360 0.08366013072 6.69E+06
3 200 1620 15840 0.2045454545 8.18E+06
4 100 3180 20540 0.3096397274 6.19E+06
5 50 8960 17080 1.049180328 1.05E+07
6 25 14440 24260 1.190436933 5.95E+06 7.29E+06
7 Untransduced 1 6.4 17940 0.0007134894091 1.43E+02
Table: Example dilutions and titrations

Reference

Wang Y, Bergelson S, Feschenko M. Determination of Lentiviral Infectious Titer by a Novel Droplet Digital PCR Method. Hum Gene Ther Methods. 2018 Apr;29(2):96-103. doi: 10.1089/hgtb.2017.198. PMID: 29378428 (Link opens in a new window).