Human CRISPR Knockout Pooled Library (Brunello)
(Pooled Libraries #73179, #73179-LV, #73178, #73178-LV)

• Purpose:

  The human CRISPR Brunello lentiviral pooled libraries were designed using optimized metrics which combine improved on-target activity predictions (Rule Set 2), with an off-target score, the Cutting Frequency Determination (CFD).

• Vector Backbone:

  • lentiCRISPR v2 (Plasmid #52961) backbone (one-vector system) - expresses Cas9
  • lentiGuide-Puro (Plasmid #52963) backbone (two-vector system) - does not express Cas9

• Depositing Labs: David Root, John Doench
• Publication: Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.

Library Details

• Species: Human
• Genes targeted: 19,114
• gRNAs: 76,441
• Controls: 1,000
• Lentiviral Generation: 3rd

Library Shipping

Each library is delivered in microcentrifuge tubes on blue ice. A tube's contents will not necessarily be frozen. For best results, minimize freeze/thaw cycles.

For the 2 plasmid system only: A Cas9 plasmid is NOT included with this library and will have to be ordered separately.

• Volume: ∼20 µL
• Concentration: 50 ng/µL

Resource Information

• Protocols:
  • Library Amplification Protocol (PDF, 90 KB)
  • Sequencing Protocol (PDF, 162 KB)
• Depositor Data:
  • Brunello Library Target Genes (TXT, 9.2 MB)
  • Brunello sgRNA Abundance Graph (PDF, 46 KB)

Terms and Licenses

Academic/Nonprofit Terms:

• UBMTA

Industry Terms:

• Not Available to Industry

Trademarks:

• Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see Sanson et al. Nat Commun. (2018) for additional information.

NOTE: Lentiviral vectors can recombine during library amplification, resulting in an ~1 kb band containing the origin and ampicillin resistance cassette. This recombination product should not adversely affect library function as it does not contain lentiviral packaging sequences or the PuroR gene and will not be selected during screening. If this 1 kb band is observed after amplification, we recommend starting with a larger prep (gigaprep) from the original sample or gel purifying the amplified library to remove the recombinant band and performing another transformation with the purified sample.

Information for Lentiviral Prep (Catalog # 73179-LV, One-vector system)

Purpose

Ready-to-use lentiviral pooled library for CRISPR screening in human cells. This backbone contains SpCas9 and unique gRNAs, and can be used to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPR v2.

Delivery

• Volume: Varies depending on titer.
• Titer: ≥2x10⁶ TU/mL
• Storage: Store at -80 ℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPRO
• Selectable Marker: Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Pooled Library Representation:

• To confirm library representation and distribution, we perform next-generation sequencing on the purified plasmid DNA pool that was used to generate lentivirus.

Titering Method:

• ddPCR: 293T cells are transduced with serial dilutions of 73179-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.

PCR confirmation of insert:

• PCR was carried out with primers targeting the Cas9 and P2A. The PCR product was visualized on an agarose gel for size confirmation.
  • Forward primer: AGAGCAGGCCGAGAATATCA

  • Reverse Primer: ACATCTCCGGCTTGTTTCAG

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.3×10⁸ infectious units are shipped on dry ice at a titer of ≥2×10⁶ TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using the testing aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in the original publication. Before using this virus, Addgene strongly recommends reading the original publication (Doench et al., 2016).

A brief and partial description of how to use this virus:

1. Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5×10⁶ suspension (or 3×10⁶ adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.

2. The Brunello CRISPR knockout pooled library has 76,441 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~3.06×10⁷ infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 6.12×10⁷ cells to ultimately achieve 3.06×10⁷ infected cells.

3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5×10⁶ suspension (or 3×10⁶ adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

4. Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 3–10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

• This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in the original publication (Doench et al., 2016), perform screen analysis by determining the log₂-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014).

• The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.

Information for Lentiviral Prep (Catalog # 73178-LV, Two-vector system)

Purpose

Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Use on cells that are stably expressing Cas9 to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiGuide-Puro.

Delivery

• Volume: Varies depending on titer.
• Titer: ≥1x10⁷ TU/mL
• Storage: Store at -80 ℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPro SFM
• Selectable Marker: Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Pooled Library Representation:

• To confirm library representation and distribution, we perform next-generation sequencing on the purified plasmid DNA pool that was used to generate lentivirus.

Titering Method:

• ddPCR: 293T cells are transduced with serial dilutions of 73178-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.

PCR confirmation of insert:

• PCR was carried out with primers targeting the U6 and EF1-alpha promoters. The PCR product was visualized on an agarose gel for size confirmation.
  • Forward primer: GAGGGCCTATTTCCCATGATT

  • Reverse Primer: CACGGCGACTACTGCACTTA

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.3×10⁸ infectious units are shipped on dry ice at a titer of ≥1×10⁷ TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using 1 mL of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in the original publication. Before using this virus, Addgene strongly recommends reading the original publication (Doench et al., 2016).

A brief and partial description of how to use this virus:

1. Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5×10⁶ suspension (or 3×10⁶ adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.

2. The Brunello CRISPR knockout pooled library has 76,441 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~3.06×10⁷ infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 6.12×10⁷ cells to ultimately achieve 3.06×10⁷ infected cells.

3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5×10⁶ suspension (or 3×10⁶ adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

4. Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 3–10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

• This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in the original publication (Doench et al., 2016), perform screen analysis by determining the log₂-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014).

• The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.