Sequence Analyzer: pAGM9121_Kma-Inulinase SP
- Download:
- GenBank File
- SnapGene File
- File Help
Map View
| Click here to try SnapGene |
Sequence View
Restriction Enzymes
Instructions: By default, all cutters are shown. Filter on number of cut sites or search by enzyme name.
Filter
| Enzyme | Cut Site (bp) | Total Cuts |
|---|---|---|
| AcuI | 429, 1519 | 2 |
| AjuI | 592, 624 | 2 |
| AlfI | 1138, 1172 | 2 |
| AlwNI | 1652 | 1 |
| ApaLI | 558, 1747 | 2 |
| ApoI | 1026, 1088 | 2 |
| ArsI | 138, 170 | 2 |
| AvaI | 175 | 1 |
| BaeGI | 562, 1751 | 2 |
| BarI | 2049, 2081 | 2 |
| BcgI | 240, 274 | 2 |
| BciVI | 1863 | 1 |
| BclI | 481 | 1 |
| BdaI | 1962, 1996 | 2 |
| BfuAI | 630 | 1 |
| BglI | 915 | 1 |
| BlpI | 592 | 1 |
| Bme1580I | 562, 1751 | 2 |
| BmrI | 11, 827, 923, 932 | 4 |
| BpmI | 535 | 1 |
| BpuEI | 1113, 1437, 1678, 1976 | 4 |
| BsaAI | 1040 | 1 |
| BsaHI | 337, 1104 | 2 |
| BsaI | 2053, 2101 | 2 |
| BsaWI | 749, 1708, 1855 | 3 |
Features
| Feature | Location (bp) | Size | Color | Direction | Type |
|---|---|---|---|---|---|
| SmR | 285 .. 1076 | 792 | CDS | ||
| ori | 1417 .. 2005 | 589 | rep_origin |
Primers
| Primer Name | Sequence (5' to 3') | Binding Sites (bp) | Length (bases) | Direction |
|---|---|---|---|---|
| pBR322ori-F | GGGAAACGCCTGGTATCTTT | 1906 .. 1925 | 20 |
BLAST
BLAST (Basic Local Alignment Search Tool) finds regions of similarity between biological sequences. Click on the buttons below to submit a BLAST search to NCBI. The results will appear in a new window. See your recent BLAST results on NCBI's website.
-
Nucleotide-Nucleotide BLAST (BLASTN)
-
Translated Nucleotide-Protein BLAST (BLASTX)
-
Sequence alignment using BLAST (BLAST2)
Sequence Analyzer Guide
- Map
Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Hovering over data labels will display additional information (e.g. cut site)
To select a portion of sequence, click one location on the plasmid and then a second location to display the sequence between the two locations.
- Sequence
Displays both strands of base paired nucleotide sequences with annotated enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Hovering over data labels will display additional information (e.g. cut site).
To select a portion of sequence, click one location on the sequence and then a second location to display the sequence between the two locations.
- Enzymes
List of restriction enzymes that can cut a given nucleotide sequence. Table lists enzyme name and the sequence location of the cut.
- Features
List of common features detected in a given nucleotide sequence. Table lists feature name, location, size, color used to indicate its position on the map, and direction (if relevant).
- Primers
List of commonly used primers detected in a given nucleotide sequence. Table lists primer name, sequence, length, binding site location, and direction.
- BLAST
Use Basic Local Alignment Search Tool (BLAST) via the NCBI website to determine similarity between a given sequence and nucleotide (BLASTN) or protein (BLASTX) sequence databases. Additionally, align a custom nucleotide sequence against a given sequence using BLAST2.
File Downloads
- GenBank
File contains the nucleotide sequence and annotated features in GenBank flat file format. Open the file with a text editor or plasmid mapping software to view the sequence.
- SnapGene
File contains the nucleotide sequence and enhanced annotations from SnapGene Server. Open the file with SnapGene software or the free Viewer to view the plasmid map, sequence, and perform additional sequence analysis.