Hbb
Description
hemoglobin beta chain complex
Also known as
Species
Mus musculus
Entrez ID
15127
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids containing this gene, or a homologous gene.
ID | Plasmid | Gene/Insert | PI |
---|---|---|---|
86194 | pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB | beta Globin (Homo sapiens) | Singer |
86212 | pPonA-BI-Gl NORM-LacZA TER- LacZB | beta-Globin (Homo sapiens) | Singer |
99692 | pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb | dCas9 and gRNA targeting Hbb (Synthetic) | Church |
99693 | pAAV-CMV-dSa VP64 Hbb | dCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Mus musculus) | Church |
189793 | PonA-BI-Gl-WT-18xPP7-WT-24xMS2 (Switch) | beta-globin (Homo sapiens) | Singer |