Skip to main content
Addgene

Hbb


Description hemoglobin beta chain complex
Also known as
Species Mus musculus
Entrez ID 15127
Orthologs

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene

ID Plasmid Gene/Insert PI
86194pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZBbeta Globin (Homo sapiens) Singer
86212pPonA-BI-Gl NORM-LacZA TER- LacZBbeta-Globin (Homo sapiens) Singer
99692pAAV-SCP1-dSa VPR mini.-2X snRP-1 HbbdCas9 and gRNA targeting Hbb (Synthetic) Church
99693pAAV-CMV-dSa VP64 HbbdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Mus musculus) Church
189793PonA-BI-Gl-WT-18xPP7-WT-24xMS2 (Switch)beta-globin (Homo sapiens) Singer