Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Hbb


Description hemoglobin beta chain complex
Also known as
Species Mus musculus
Entrez ID 15127

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
86194pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZBbeta Globin (Homo sapiens) Singer
86212pPonA-BI-Gl NORM-LacZA TER- LacZBbeta-Globin (Homo sapiens) Singer
99692pAAV-SCP1-dSa VPR mini.-2X snRP-1 HbbdCas9 and gRNA targeting Hbb (Synthetic) Church
99693pAAV-CMV-dSa VP64 HbbdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Mus musculus) Church
189793PonA-BI-Gl-WT-18xPP7-WT-24xMS2 (Switch)beta-globin (Homo sapiens) Singer