Gata1
Description
GATA binding protein 1
Also known as
Gata-1, Gf-1, eryf1
Species
Mus musculus
Entrez ID
14460
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids containing this gene
| ID | Plasmid | Gene/Insert | PI |
|---|---|---|---|
| 13626 | pMT2 GATA1 | GATA1 (Mus musculus) | Rao |
| 41085 | FUW-TetO-Gata1 | Gata1 (Mus musculus) | Jaenisch |
| 85693 | pcDNA3 GATA1 | GATA1 (Mus musculus) | Del Sal |
| 85694 | pcDNA3 GATA1 K137R | GATA1 (Mus musculus) | Del Sal |
| 181976 | pLeGO.sgGata1.4.RUNX1A.iG2 | GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) | Klusmann |