Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CLTA


Description clathrin light chain A
Also known as LCA
Species Homo sapiens
Entrez ID 1211

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene

ID Plasmid Gene/Insert PI
59353GFP-FKBP-LCaClathrin Light Chain A (Homo sapiens) Royle
70217pEGFP-GFP11-Clathrin light chainGFP11-Clathrin light chain (Homo sapiens) Huang
83032pEGFP_sfCherry2(11)_Clathrin light chainsfCherry2(11)_Clathrin light chain (Homo sapiens) Huang
112016CLTA-GFP HDRT Source (pTR 153)CLTA-GFP HDRT (Homo sapiens) Marson
112017CLTA-mCherry HDRT Source (pTR 177)CLTA-mCherry HDRT (Homo sapiens) Marson
186128pTR-177 pUC19-CLTA-N-mCherryCLTA (Homo sapiens) Marson
217345gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert