Actc1
Description
actin, alpha, cardiac muscle 1
Also known as
Actc-1
Species
Mus musculus
Entrez ID
11464
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids containing this gene
| ID | Plasmid | Gene/Insert | PI |
|---|---|---|---|
| 99690 | pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1 | dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Mus musculus) | Church |
| 99691 | pAAV-CMV-dSa VP64 Actc1 | dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Mus musculus) | Church |
| 99694 | pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2 | dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus) | Church |
| 128326 | pSB700-mouse-ACTC1-Puro | gRNA against mouse ACTC1 for activation (Mus musculus) | Chavez |