Actc1

Description actin, alpha, cardiac muscle 1

Also known as Actc-1

Species Mus musculus

Entrez ID 11464

Orthologs Homo sapiens, Rattus norvegicus, Gallus gallus, Bos taurus

You can receive an email alert when new materials related to this gene are available at Addgene.

Plasmids containing this gene

Showing 1 to 4 of 4 entries

Show entries

Search table:

ID	Plasmid	Gene/Insert	PI
128326	pSB700-mouse-ACTC1-Puro	gRNA against mouse ACTC1 for activation (Mus musculus)	Chavez
99694	pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2	dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus)	Church
99691	pAAV-CMV-dSa VP64 Actc1	dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Mus musculus)	Church
99690	pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1	dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Mus musculus)	Church