Orthogonal Cas9 proteins for RNA-guided gene regulation and editing.
Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM
Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 48645 | DS-SPcas | Bacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin |
| 48646 | DS-NMcas | Bacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin |
| 48647 | DS-ST1cas | Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin |
| 48649 | PM-SP!TA | Bacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol |
| 48650 | PM-SP!TB | Bacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol |
| 48651 | PM-NM!TA | Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol |
| 48652 | PM-NM!TB | Bacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol |
| 48653 | PM-ST1!TA | Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol |
| 48654 | PM-ST1!TB | Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol |
| 48655 | PM-TD!TA | Bacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol |
| 48656 | PM-TD!TB | Bacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol |
| 48659 | DS-ST1casN- | Bacterial nuclease-null ST1 Cas9 expression |
| 48660 | DS-TDcasN- | Bacterial nuclease-null TD Cas9 expression |
| 48661 | SK-YFP-SPNM-B | Bacterial SP and NM repression YFP reporter: protospacer B |
| 48662 | SK-YFP-ST1-B | Bacterial ST1 repression YFP reporter: protospacer B |
| 48663 | SK-YFP-TD-B | Bacterial TD repression YFP reporter: protospacer B |
| 48664 | SK-YFP-NM-A | Bacterial NM repression YFP reporter: protospacer A |
| 48665 | SK-YFP-ST1-A | Bacterial ST1 repression YFP reporter: protospacer A |
| 48666 | SK-YFP-TD-A | Bacterial TD repression YFP reporter: protospacer A |
| 48667 | EE-SP!gIII | Bacterial SP Cas9 targeting filamentous phage gene III at five protospacers |
| 48668 | M-SPcas | Mammalian S. pyogenes Cas9 expression, human optimized |
| 48669 | M-ST1cas | Mammalian S. thermophilus #1 Cas9 expression, human optimized |
| 48670 | M-NMcas | Mammalian N. meningitidis Cas9 expression, human optimized |
| 48671 | M-SP-sgRNA | Mammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG |
| 48672 | M-ST1-sgRNA | Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG |
| 48673 | M-NM-sgRNA | Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG |
| 48674 | M-SPn-VP64 | Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized |
| 48675 | M-ST1n-VP64 | Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized |
| 48676 | M-NMn-VP64 | Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized |
| 48677 | M-tdTom-SP | Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer |
| 48678 | M-tdTom-ST1 | Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer |
| 48679 | M-tdTom-NM | Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer |