Orthogonal Cas9 proteins for RNA-guided gene regulation and editing.
Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM
Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Orthogonal CRISPR/Cas9 Systems
We have characterized a set of orthogonal Cas9 proteins to allow multiple Cas9-mediated activities to be performed simultaneously within individual cells. Because these proteins recognize different guide RNAs, they can be independently targeted to distinct sets of sequences. Our currently available set of Cas9 proteins includes three orthogonal variants optimized for use in human cells and four orthogonal variants usable in bacteria.
Cas9 proteins in human cells:
Streptococcus pyogenes (SP): This is the classical Cas9 protein used in most studies to date.
Neisseria meningitidis (NM): Significantly smaller than the above Cas9 protein, NM is comparably active as a nuclease and a transcriptional activator.
Streptococcus thermophilus #1 (ST1): Almost as small as NM, ST1 consistently yields slightly higher activities than the others as a nuclease and as an activator, but is more restricted in the sequences it can target.
Cas9 proteins in bacteria:
SP, NM, ST1: all of these efficiently mediate cutting and repression in bacteria, with NM exhibiting slightly superior repression.
Treponema denticola (TD): Larger than SP, it mediates efficient cutting and nicking in bacteria but performs poorly as a transcriptional repressor.
All genes except the SP nuclease are human codon optimized but function well in E. coli . Bacteria expressing NM and TD may grow slightly more slowly than those expressing SP and ST1.
Protospacer-adjacent motifs (PAMs):
Please note that NM, ST1, and TD recognize different PAMs than does the classical SP Cas9. We experimentally determined these PAMs using a highly stringent selection, which revealed that PAM recognition is more complex than previously thought. In particular, combinations of highly unfavorable bases at positions adjacent to those formally required can significantly reduce activity, while particular protospacers interact nonlinearly with different PAM sequences to determine overall activity at the site. For example, when paired with either of the protospacers utilized in our selection, we observed that NM will recognize sequences with PAMs matching:
NNNNGA, NNNNGTT, NNNNGNNT,
just as well as the PAM determined by bioinformatics, NNNNGATT. However, it is possible that NNNNGATT will prove superior for less favorable protospacers and applications requiring particularly tight binding. In these cases it may be advisable to use the consensus sequence. See the publication for details.
A protocol for synthesizing gRNAs: Cas9 orthologs gRNA cloning protocol (PDF, 107 KB)
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 48645 | DS-SPcas | Bacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin |
| 48646 | DS-NMcas | Bacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin |
| 48647 | DS-ST1cas | Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin |
| 48649 | PM-SP!TA | Bacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol |
| 48650 | PM-SP!TB | Bacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol |
| 48651 | PM-NM!TA | Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol |
| 48652 | PM-NM!TB | Bacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol |
| 48653 | PM-ST1!TA | Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol |
| 48654 | PM-ST1!TB | Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol |
| 48655 | PM-TD!TA | Bacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol |
| 48656 | PM-TD!TB | Bacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol |
| 48659 | DS-ST1casN- | Bacterial nuclease-null ST1 Cas9 expression |
| 48660 | DS-TDcasN- | Bacterial nuclease-null TD Cas9 expression |
| 48661 | SK-YFP-SPNM-B | Bacterial SP and NM repression YFP reporter: protospacer B |
| 48662 | SK-YFP-ST1-B | Bacterial ST1 repression YFP reporter: protospacer B |
| 48663 | SK-YFP-TD-B | Bacterial TD repression YFP reporter: protospacer B |
| 48664 | SK-YFP-NM-A | Bacterial NM repression YFP reporter: protospacer A |
| 48665 | SK-YFP-ST1-A | Bacterial ST1 repression YFP reporter: protospacer A |
| 48666 | SK-YFP-TD-A | Bacterial TD repression YFP reporter: protospacer A |
| 48667 | EE-SP!gIII | Bacterial SP Cas9 targeting filamentous phage gene III at five protospacers |
| 48668 | M-SPcas | Mammalian S. pyogenes Cas9 expression, human optimized |
| 48669 | M-ST1cas | Mammalian S. thermophilus #1 Cas9 expression, human optimized |
| 48670 | M-NMcas | Mammalian N. meningitidis Cas9 expression, human optimized |
| 48671 | M-SP-sgRNA | Mammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG |
| 48672 | M-ST1-sgRNA | Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG |
| 48673 | M-NM-sgRNA | Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG |
| 48674 | M-SPn-VP64 | Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized |
| 48675 | M-ST1n-VP64 | Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized |
| 48676 | M-NMn-VP64 | Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized |
| 48677 | M-tdTom-SP | Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer |
| 48678 | M-tdTom-ST1 | Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer |
| 48679 | M-tdTom-NM | Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer |