Jolanda Van Leeuwen Lab: van Leeuwen Lab plasmids 2025

Unpublished

Plasmids from Article

ID	Plasmid	Purpose
232881	pML104-HIS3-2	Plasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.
232882	pML104-HIS3-3	Plasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.
232883	pML104-LEU2-2	Plasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.
232887	pML107-ADE13	Plasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.
232889	pML107-AVO1	Plasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.
232890	pML107-INO80	Plasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.
232892	pML107-LAS17	Plasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.
232896	pML107-SRP14	Plasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.
232897	pML107-TLG1	Plasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.
232898	pML107-VHT1	Plasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.
232900	pML107-YFR054C	Plasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.
232901	pML107-ZIM17	Plasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.
232902	pRS313-rad53-5004	Plasmid carrying the rad53-5004 allele with its native promoter and terminator.