Genetic suppression interactions are highly conserved across genetic backgrounds
Paltenghi C, van Leeuwen J
bioRxiv 2024.08.28.610086
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 226263 | pML104-LEU2-2 | Plasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene |
| 226264 | pML107-PMR1 | Plasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 gene |
| 226265 | pML107-LUG1 | Plasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 gene |
| 226266 | pRS313-SCT1-S288C | Plasmid expressing the SCT1 allele from S288C, under control of its native promoter |
| 226267 | pRS313-SCT1-L1374 | Plasmid expressing the SCT1 allele from L-1374, under control of its native promoter |
| 226268 | pRS313-SCT1-UWOPS872421 | Plasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoter |
| 226269 | pRS313-SCT1-NCYC110 | Plasmid expressing the SCT1 allele from NCYC110, under control of its native promoter |
| 226270 | pRS315-SEC22-S288C | Plasmid expressing the SEC22 allele from S288C, under control of its native promoter |
| 226271 | pRS315-SEC22-L1374 | Plasmid expressing the SEC22 allele from L-1374, under control of its native promoter |
| 226272 | pRS315-SEC22-UWOPS872421 | Plasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoter |
| 226273 | pRS315-SEC22-NCYC110 | Plasmid expressing the SEC22 allele from NCYC110, under control of its native promoter |
| 226274 | pRS316-SEC18-S288C | Plasmid expressing the SEC18 allele from S288C, under control of its native promoter |
| 226275 | pRS316-SEC18-L1374 | Plasmid expressing the SEC18 allele from L-1374, under control of its native promoter |
| 226276 | pRS316-SEC18-UWOPS872421 | Plasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoter |
| 226277 | pRS316-SEC18-NCYC110 | Plasmid expressing the SEC18 allele from NCYC110, under control of its native promoter |
| 226279 | pRS316-SSD1-NCYC110 | Plasmid expressing the SSD1 allele from NCYC110, under control of its native promoter |