Systematic analysis of the molecular and biophysical properties of key DNA damage response factors.

Heyza JR, Mikhova M, Bahl A, Broadbent DG, Schmidt JC
Elife. 2023 Jun 21;12:e87086. doi: 10.7554/eLife.87086. PubMed Article

Plasmids from Article

ID	Plasmid	Purpose
207078	Halo-SHLD2 HRD	Homologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus.
207080	RNF168-Halo HRD	Homologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF168 locus.
207081	Rif1-Halo HRD	Homologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RIF1 locus.
207083	RNF169-Halo HRD	Homologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF169 locus.
207089	ATM N-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.
207090	MDC1 N-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.
207091	53BP1 N-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.
207092	NBS1 C-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.
207094	SHLD3 N-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.
207097	ATM C-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.
207098	SHLD2 N-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.
207099	RNF169 C-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.
207101	SHLD1 N-terminal sgRNA	pX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.
207102	HaloTag KO sgRNA	pX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.
207103	MDC1 KO sgRNA	pX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.
207104	53BP1 KO sgRNA	pX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.
207105	SHLD3 KO sgRNA #1	pX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..
207106	SHLD3 KO sgRNA #2	pX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..
207109	Halo-MDC1 PST deletion	pHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 with a deletion of the PST repeat region in human cells.
207110	Halo-MDC1 BRCT domain deletion	pHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 with a deletion of the BRCT domain in human cells.