MASTL promotes cell contractility and motility through kinase-independent signaling.
Taskinen ME, Narva E, Conway JRW, Hinojosa LS, Lilla S, Mai A, De Franceschi N, Elo LL, Grosse R, Zanivan S, Norman JC, Ivaska J
J Cell Biol. 2020 Jun 1;219(6). pii: 151688. doi: 10.1083/jcb.201906204.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 191011 | pcDNA-EGFP MASTL WT (siRNA resistant) | Expresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA) |
| 191012 | pcDNA-EGFP MASTL G44S (siRNA resistant) | Expresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA) |
| 191013 | pcDNA-EGFP MASTL E167D (siRNA resistant) | Expresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA) |