Ayaz Najafov Lab: Najafov lab plasmids
Unpublished
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 185357 | pcDNA3.1-N-Luc | For mammalian expression of N-terminal half of Firefly luciferase for split-Luciferase experiments (amino acids 2-416). |
| 185358 | pcDNA3.1-C-Luc | For mammalian expression of C-terminal half of Firefly luciferase for split-Luciferase experiments (amino acids 398-550). |
| 185359 | pcDNA5-FRT/TO-Hygro-3xFLAG | Vector backbone for mammalian expression of proteins with an N-terminal 3xFLAG tag. |
| 185360 | pcDNA3.1-nCFP | For mammalian expression of N-term CFP for split-CFP |
| 185361 | pcDNA3.1-cCFP | For mammalian expression of C-term CFP for split-CFP |
| 185362 | pEBG-hOSR1-Flag | For mammalian expression of human GST-OSR1-Flag |
| 185363 | pEBG-hOSR1-Flag-D164A | For mammalian expression of human GST-OSR1-Flag-D164A (kinase-dead) |
| 185364 | pLKO-puro-mAK1-shRNA-1 | For mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase) |
| 185365 | pX459-puro-hBRAF-1 | For mammalian expression of guide RNA: caccgACAACAGTTATTGGAATCTC that targets human BRAF |
| 185366 | pX459-puro-hBRAF-2 | For mammalian expression of guide RNA: caccgAAAATCCCACAGATGTGGCA that targets human BRAF |
| 185367 | pX459-puro-hARAF-1 | For mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAF |
| 185370 | pLKO-Tet-puro-hARAF-shRNA-1 | For tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAF |
| 185371 | pLKO-Tet-puro-hRAF1-shRNA-1 | For tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1 |
| 185373 | pcDNA5-FRT-hMYC | For mammalian expression of human MYC |
| 185374 | pEBG-hMYC-FLAG | For mammalian expression of human GST-MYC-FLAG |
| 185375 | pcDNA5-FRT-GFP-MYC | For mammalian expression of human GFP-MYC |
| 185376 | pX459-puro-hMYC | For mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYC |
| 185377 | pX459-puro-hGSDMD | For mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D) |
| 185378 | pX459-puro-hCASP8 | For mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8) |
| 185379 | pX459-puro-hPKAalpha | For mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alpha |
| 185380 | pcDNA5-FRT-TO-hPKAalpha-Flag | For mammalian expression of human PKAalpha-FLAG |
| 185381 | pEBG-hPKAalpha-Flag | For mammalian expression of human GST-PKAalpha-FLAG |
| 185382 | pLKO-puro-hPPM1A | For mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1A |
| 185383 | pLKO-puro-hPPM1B | For mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1B |