Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Ayaz Najafov Lab: Najafov lab plasmids

Unpublished

Plasmids from Article

ID Plasmid Purpose
185357pcDNA3.1-N-LucFor mammalian expression of N-terminal half of Firefly luciferase for split-Luciferase experiments (amino acids 2-416).
185358pcDNA3.1-C-LucFor mammalian expression of C-terminal half of Firefly luciferase for split-Luciferase experiments (amino acids 398-550).
185359pcDNA5-FRT/TO-Hygro-3xFLAGVector backbone for mammalian expression of proteins with an N-terminal 3xFLAG tag.
185360pcDNA3.1-nCFPFor mammalian expression of N-term CFP for split-CFP
185361pcDNA3.1-cCFPFor mammalian expression of C-term CFP for split-CFP
185362pEBG-hOSR1-FlagFor mammalian expression of human GST-OSR1-Flag
185363pEBG-hOSR1-Flag-D164AFor mammalian expression of human GST-OSR1-Flag-D164A (kinase-dead)
185364pLKO-puro-mAK1-shRNA-1For mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase)
185365pX459-puro-hBRAF-1For mammalian expression of guide RNA: caccgACAACAGTTATTGGAATCTC that targets human BRAF
185366pX459-puro-hBRAF-2For mammalian expression of guide RNA: caccgAAAATCCCACAGATGTGGCA that targets human BRAF
185367pX459-puro-hARAF-1For mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAF
185370pLKO-Tet-puro-hARAF-shRNA-1For tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAF
185371pLKO-Tet-puro-hRAF1-shRNA-1For tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1
185373pcDNA5-FRT-hMYCFor mammalian expression of human MYC
185374pEBG-hMYC-FLAGFor mammalian expression of human GST-MYC-FLAG
185375pcDNA5-FRT-GFP-MYCFor mammalian expression of human GFP-MYC
185376pX459-puro-hMYCFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYC
185377pX459-puro-hGSDMDFor mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)
185378pX459-puro-hCASP8For mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)
185379pX459-puro-hPKAalphaFor mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alpha
185380pcDNA5-FRT-TO-hPKAalpha-FlagFor mammalian expression of human PKAalpha-FLAG
185381pEBG-hPKAalpha-FlagFor mammalian expression of human GST-PKAalpha-FLAG
185382pLKO-puro-hPPM1AFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1A
185383pLKO-puro-hPPM1BFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1B

Antibodies from Article