Ayaz Najafov Lab: Najafov lab plasmids

Unpublished

Plasmids from Article

Showing 1 to 10 of 24 entries

Show 102550100All entries

Search table:

• Previous
• 1
• 2
• 3
• Next

ID	Plasmid	Purpose
185383	pLKO-puro-hPPM1B	For mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1B
185382	pLKO-puro-hPPM1A	For mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1A
185381	pEBG-hPKAalpha-Flag	For mammalian expression of human GST-PKAalpha-FLAG
185380	pcDNA5-FRT-TO-hPKAalpha-Flag	For mammalian expression of human PKAalpha-FLAG
185379	pX459-puro-hPKAalpha	For mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alpha
185378	pX459-puro-hCASP8	For mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)
185377	pX459-puro-hGSDMD	For mammalian expression of guide RNA: CGCGCCAGACGCGCCACCCT that targets human GSDMD (Gasdermin D)
185376	pX459-puro-hMYC	For mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYC
185375	pcDNA5-FRT-GFP-MYC	For mammalian expression of human GFP-MYC
185374	pEBG-hMYC-FLAG	For mammalian expression of human GST-MYC-FLAG