Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Differentially Optimized Cell-Free Buffer Enables Robust Expression from Unprotected Linear DNA in Exonuclease-Deficient Extracts.

Batista AC, Levrier A, Soudier P, Voyvodic PL, Achmedov T, Reif-Trauttmansdorff T, DeVisch A, Cohen-Gonsaud M, Faulon JL, Beisel CL, Bonnet J, Kushwaha M
ACS Synth Biol. 2022 Jan 16. doi: 10.1021/acssynbio.1c00448. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
177369sTR056Toehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.
177370sTR060Trigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.

Antibodies from Article