RNA is essential for PRC2 chromatin occupancy and function in human pluripotent stem cells.
Long Y, Hwang T, Gooding AR, Goodrich KJ, Rinn JL, Cech TR
Nat Genet. 2020 Sep;52(9):931-938. doi: 10.1038/s41588-020-0662-x. Epub 2020 Jul 6.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 171031 | pYL214 | CRISPR plasmids encodes Cas9 and a sgRNA targeting EZH2 exon 2 - intron 2 junction (sequence: GCAGACGAGCTGATGAAGTAA) |
| 173184 | pYL236 | CRISPR donor plasmid for making the WT EZH2 control cell line. It contains a puromycin resistance gene and an mCherry gene |
| 173194 | pYL237 | CRISPR donor plasmid for making the RNA-binding mutant EZH2 control cell line. It contains a puromycin resistance gene and an mCherry gene |
| 173717 | pcDNA3.1_3xFlagEzh2 WT | WT EZH2 expression plasmid with 3XFLAG tag |
| 173718 | pcDNA3.1_3xFlagEzh2 RNA binding mutant | RNA-binding mutant EZH2 expression plasmid with 3XFLAG tag |