A versatile plasmid architecture for mammalian synthetic biology (VAMSyB).

Haellman V, Strittmatter T, Bertschi A, Stucheli P, Fussenegger M
Metab Eng. 2021 Jul;66:41-50. doi: 10.1016/j.ymben.2021.04.003. Epub 2021 Apr 18. PubMed Article

Plasmids from Article

ID	Plasmid	Purpose
169477	pVH8-Tier1-PhCMV-NLS	Tier-1 vector encoding PhCMV-driven nuclear localization signal expression (PhCMV-NLS-pA).
169478	pVH9-Tier1-PhCMV-3xNLS	Tier-1 vector encoding PhCMV-driven triple nuclear localization signal expression (PhCMV-3xNLS-pA).
169479	pTS2378-Tier1-PhCMV-KDEL	Tier-1 vector encoding PhCMV-driven ER-retention signal KDEL (PhCMV-KDEL-pA).
169481	pTS2412-Tier1-PPGK-2xGS	Tier-1 vector encoding PPGK-controlled 2x (GGGGS)-linker (PPGK-2xGS-pA).
169482	pTS2415-Tier1-PPGK-1xEAAAK	Tier-1 vector encoding PPGK-controlled 1x (AEAAAK)-linker (PPGK-AEAAAK-pA).
169484	pTS2379-Tier1-PhCMV-PEST	Tier-1 vector encoding PhCMV-driven PEST tag for destabilization of proteins (PhCMV-PEST-pA).
169485	pTS2380-Tier1-PhCMV-TM	Tier-1 vector encoding PhCMV-driven transmembrane domain from Junctophilin-1 (TM) (PhCMV-TM-pA).
169486	pMM585-Tier1-PhCMV-Igk	Tier-1 vector encoding PhCMV-driven secretion signal Igk (PhCMV-Igk-pA).
169487	pTS2381-Tier1-PhCMV-Igk_TM	Tier-1 vector encoding PhCMV-driven transmembrane domain from Junctophilin-1 (TM) for membrane localization of fusion proteins attached to a secretion signal Igk (PhCMV-IgkSS-TM-pA).
169488	pTS2409-Tier1-PhCMV-FURINsite	Tier-1 vector encoding PhCMV-controlled FURIN protease recognition site (PhCMV-FURINsite-pA).
169489	pVH17-Tier1-PhCMV-myr	Tier-1 vector encoding PhCMV-driven myristoylation (myr) signal peptide expression (PhCMV-myr-pA).
169490	pTS1051-Tier1-PhCMV-4xCox8	Tier-1 vector encoding PhCMV-driven four-fold repeat of a mitochondrial matrix localization signal derived from mitochondrial matrix protein Cox8 (PhCMV-4xCox8-pA)
169491	pTS1018-Tier1-PhCMV-p2A	Tier-1 vector encoding a self-cleaving peptides p2a sequence (PhCMV-p2A-pA).
169492	pTS1021-Tier1-PhCMV-PuroR	Tier-1 vector encoding PhCMV-driven marker for puromycin selection (PhCMV-PuroR-pA)
169493	pTS2401-Tier1-PhCMV-HygroR	Tier-1 vector encoding PhCMV-driven hygromycin resistance gene HygroR (PhCMV-HygroR-pA).
169494	pTS2402-Tier1-PhCMV-BlastR	Tier-1 vector encoding PhCMV-driven blasticidin resistance gene BlastR (PhCMV-BlastR-pA).
169495	pTS2403-Tier1-PhCMV-ZeoR	Tier-1 vector encoding PhCMV-driven zeocin resistance gene ZeoR (PhCMV-ZeoR-pA).
169496	pTS2404-Tier1-PhCMV-NeoR	Tier-1 vector encoding PhCMV-driven neomycin resistance gene NeoR (PhCMV-NeoR-pA).
169497	pTS1023-Tier1-PhCMV-p2A-PuroR	Tier-1 vector encoding PhCMV-driven p2A sequence fused to a marker for puromycine selection (PhCMV-p2A-PuroR-pA).
169498	pTS1047-Tier1-PhCMV-YPet-p2A-PuroR	Tier-1 vector encoding PhCMV-driven YPet in combination with a marker for puromycin selection (PhCMV-YPet-p2A-PuroR-pA).
169499	pTS1024-Tier1-PRPBSA-YPet-p2A-PuroR	Tier-1 vector encoding PRPBSA-driven YPet in combination with a marker for puromycine selection (PRPBSA-YPet-p2A-PuroR-pA)
169500	pTS2405-Tier1-PhCMV-TEV	Tier-1 vector encoding PhCMV-driven tabacco etch virus protease TEV (PhCMV-TEV-pA).
169501	pTS2406-Tier1-PhCMV-NTEV	Tier-1 vector encoding PhCMV-driven N-terminal fragment of a split tabacco etch virus protease splitTEV (PhCMV-N-TEV-pA).
169503	pTS2408-Tier1-PhCMV-TEVsite	Tier-1 vector encoding PhCMV-controlled tabacco etch virus protease recognition site (PhCMV-TEVsite-pA).
169505	pMM545-Tier1-PhCMV-Citrine	Tier-1 vector encoding PhCMV-driven yellow fluorescent protein Citrine (PhCMV-Citrine-pA).
169506	pFOX8-Tier1-PhCMV-YPet	Tier-1 vector encoding PhCMV-driven YPet expression (PhCMV-YPet-pA).
169508	pFOX11-Tier1-PhCMV-Clover	Tier-1 vector encoding PhCMV-driven gren fluorescent protein clover (PhCMV-clover-pA).
169509	pFOX12-Tier1-PhCMV-eGFP	Tier-1 vector encoding PhCMV-driven green fluorescent protein eGFP (PhCMV-eGFP-pA).
169510	pFOX13-Tier1-PhCMV-tGFP	Tier-1 vector encoding PhCMV-driven green fluorescent protein turbo GFP (PhCMV-tGFP-pA).
169511	pFOX14-Tier1-PhCMV-mTFP1	Tier-1 vector encoding PhCMV-driven green fluorescent protein mTFP1 (PhCMV-mTFP1-pA).
169512	pFOX15-Tier1-PhCMV-mTurquoise2	Tier-1 vector encoding PhCMV-driven green fluorescent protein mTurquoise2 (PhCMV-mTurquoise2-pA).
169515	pFOX6-Tier1-PhCMV-TdTomato	Tier-1 vector encoding PhCMV-driven bright-red fluorescent protein TdTomato (PhCMV-TdTomato-pA).
169517	pTS2384-Tier1-PhCMV-medFT	Tier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "medium" maturation medFT (PhCMV-medFT-pA).
169518	pTS2385-Tier1-PhCMV-fastFT	Tier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "fast" maturation fastFT (PhCMV-fastFT-pA).
169519	pTS2386-Tier1-PhCMV-GCaMP6s	Tier-1 vector encoding PhCMV-driven calcium sensor GCaMP6s (PhCMV-GCaMP6s-pA).
169520	pVH231-Tier1-PmPGK1-mTagBFP2	Tier-1 vector encoding PmPGK1-driven mTagBFP2 expression (PmPGK1-mTagBFP2-pA).
169521	pVH230-2-Tier1-PmPGK1-YPet	Tier-1 vector encoding PmPGK1-driven YPet expression (PmPGK1-YPet-pA).
169522	pVH233-Tier1-PmPGK1-eYFP	Tier-1 vector encoding PmPGK1-driven eYFP expression (PmPGK1-eYFP-pA).
169523	pVH232-Tier1-PmPGK1-mRuby2	Tier-1 vector encoding PmPGK1-driven mRuby2 expression (PmPGK1-mRuby2-pA).
169524	pTS2387-Tier1-PhCMV-p2a_mTagBFP2	Tier-1 vector encoding PhCMV-driven blue fluorescent protein mTagBFP2 fused to a "self-cleaving" peptide p2a (PhCMV-p2a_mTagBFP2-pA).
169525	pTS2388-Tier1-PhCMV-p2a_Ypet	Tier-1 vector encoding PhCMV-driven yellow fluorescent protein YPet fused to a "self-cleaving" peptide p2a (PhCMV-p2a_YPet-pA).
169526	pTS2389-Tier1-PhCMV-p2a_mRuby	Tier-1 vector encoding PhCMV-driven red fluorescent protein mRuby2 fused to a "self-cleaving" peptide p2a (PhCMV-p2a_mRuby2-pA).
169529	pTS2392-Tier1-PhCMV-p2a_medFT	Tier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "medium" maturation medFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA).
169530	pTS2393-Tier1-PhCMV-p2a_fastFT	Tier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "fast" maturation fastFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA).
169531	pTS2394-Tier1-PhCMV-3xNLS_mTagBFP2	Tier-1 vector encoding PhCMV-driven blue fluorescent protein mTagBFP2 with nuclear localization (PhCMV-3xNLS-mTagBFP2-pA).
169532	pTS1026-Tier1-PhCMV-3xNLS-iRFP670	Tier-1 vector encoding PhCMV-driven iRFP670 that is localized to the nucleus (PhCMV-3xNLS-iRFP670-pA).
169533	pTS2395-Tier1-PhCMV-Igk_mRuby2_KDEL	Tier-1 vector encoding PhCMV-driven red fluorescent protein mRuby2 localized to the ER (PhCMV-Igk-mRuby2-KDEL-pA).
169534	pTS2396-Tier1-PhCMV-4xCOX8_Ypet	Tier-1 vector encoding PhCMV-driven yellow fluorescent protein YPet localized to the mitochondria (PhCMV-4xCOX8-YPet-pA).
169535	pTS2410-Tier1-PhCMV-Myr_mTagBFP2	Tier-1 vector encoding PhCMV-controlled plasma membrane-tethered mTagBFP2 (PhCMV-myr-mTagBFP2-pA).
169537	pTS1046-Tier1-PhCMV-4xCox8-mRuby2	Tier-1 vector encoding PhCMV-driven mRuby2 localized to the mitochondrial matrix via a four-fold Cox8 localization signal (PhCMV-4xCox8-mRuby2-pA)
169543	pVH608-Tier1-PmPGK1-Fluc	Tier-1 vector encoding PmPGK1-driven Fluc (PmPGK1-Fluc-pA).
169544	pVH41-Tier1-PhCMV-GLuc	Tier-1 vector encoding PhCMV-driven gaussia luciferase (PhCMV-GLuc-pA)
169545	pTS1011-Tier1-PhCMV-Nluc	Tier-1 vector encoding PhCMV-driven NLuc (PhCMV-NLuc-pA).
169548	pTS2303-Tier1-CoTC-PPGK-NLuc_TB	Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169549	pTS2304-Tier1-Tactb-PPGK-NLuc_TB	Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' Tactb insulator sequence (Tactb-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169550	pTS2307-Tier1-2xcHS4-PPGK-NLuc_TB	Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a tandem repeat of a 5' cHS4 insulator sequence (2xcHS4-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169551	pTS2308-Tier1-pGL3-PPGK-NLuc_TB	Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169552	pTS2311-Tier1-spacer-PPGK-NLuc_TB	Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 preluded by a 5' spacer sequence (spacer-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169557	pVH63-Tier1-PMLP-Citrine_p2a_SEAP	Tier-1 vector encoding PMLP-driven Citrine-p2A-SEAP expression (PMLP-Citrine-p2A-SEAP-pA).
169558	pVH64-Tier1-PSV40-Citrine_p2a_SEAP	Tier-1 vector encoding PSV40-driven Citrine-p2A-SEAP expression (PSV40-Citrine-p2A-SEAP-pA).
169559	pVH65-Tier1-PTK-Citrine_p2a_SEAP	Tier-1 vector encoding PTK-driven Citrine-p2A-SEAP expression (PTK-Citrine-p2A-SEAP-pA).
169560	pVH72-Tier1-PhCMV-SEAP	Tier-1 vector encoding PhCMV-driven SEAP expression containing a computationally optimized secretion peptide (PhCMV-SEAP-pA).
169561	pVH21-Tier1-PhEF1a	Tier-1 PhEF1a-driven expression vector (PhEF1a-MCS-pA).
169562	pTS2364-Tier1-IRES	Tier-1 vector carrying an internal ribosome entry site (IRES-pA)
169563	pVH227-Tier1-OTetO7-PCMVmin2-SEAP	Tier-1 vector encoding PTetO7-driven SEAP expression (OTetO7-PCMVmin-2-SEAP-pA).
169564	pVH228-Tier1-OVanO2-PCMVmin2-SEAP	Tier-1 vector encoding PVanO2-driven SEAP expression (OVanO2-PCMVmin-2-SEAP-pA).
169565	pVH229-Tier1-OTtgO2-PCMVmin2-SEAP	Tier-1 vector encoding PTtgO2-driven SEAP expression (OTtgO2-PCMVmin-2-SEAP-pA).
169566	pTS2365-Tier1-PhCMV-TetR	Tier-1 vector encoding PhCMV-driven tetracycline dependent regulator protein TetR (PhCMV-TetR-pA).
169567	pTS2366-Tier1-PhCMV_F-type	Tier-1 vector encoding PhCMV-driven F-type transactivator domain (PhCMV-F-type-pA).
169568	pTS2367-Tier1-PhCMV_VP16	Tier-1 vector encoding PhCMV-driven VP16 transactivator domain (PhCMV-VP16-pA).
169569	pTS2368-Tier1-PhCMV_VP64	Tier-1 vector encoding PhCMV-driven VP64 transactivator domain (PhCMV-VP64-pA).
169570	pVH15-Tier1-PhCMV-VPR	Tier-1 vector encoding PhCMV-driven VP64-P65-Rta expression (PhCMV-VPR-pA)
169571	pTS2369-Tier1-PhCMV_KRAB	Tier-1 vector encoding PhCMV-driven KRAB transsilencer domain (PhCMV-KRAB-pA).
169572	pVH19-Tier1-PhCMV-p300core	Tier-1 vector encoding PhCMV-driven histone acetyltransferase p300 core domain expression (PhCMV-p300core-pA)
169573	pTS2370-Tier1-PhCMV-TetR_F-type	Tier-1 vector encoding PhCMV-driven tetracycline-dependent F-type-based transactiavtor (PhCMV-TetR-F-type-pA).
169574	pVH234-Tier1-PmPGK1-tTA	Tier-1 vector encoding PmPGK1-driven tTA expression (PmPGK1-tTA-pA).
169575	pAB303-Tier1-PhCMV-TetR_VPR	Tier-1 vector encoding PhCMV-driven tetracycline-dependent VPR-based transactiavtor (PhCMV-TetR-VPR-pA).
169577	pAB300-Tier1-PhCMV-rTetR	Tier-1 vector encoding PhCMV-driven tetracycline-activated rTetR (PhCMV-rTetR-VPR-pA).
169578	pVH235-Tier1-PmPGK1-rtTA	Tier-1 vector encoding PmPGK1-driven rtTA expression (PmPGK1-rtTA-pA).
169579	pAB301-Tier1-PhCMV-rTetR_VPR	Tier-1 vector encoding PhCMV-driven tetracycline-activated VPR-based transactiavtor (PhCMV-rTetR-VPR-pA).
169581	pTS2373-Tier1-PhCMV-Gal4	Tier-1 vector encoding PhCMV-driven Gal4 DNA binding domain (PhCMV-Gal4-pA).
169582	pTS2374-Tier1-PhCMV-Gal4_VP16	Tier-1 vector encoding PhCMV-driven Gal4-VP16 transactivator (PhCMV-Gal4-VP16-pA).
169584	pVH237-2-Tier1-PmPGK1-TtgA	Tier-1 vector encoding PmPGK1-driven TtgA expression (PmPGK1-TtgA-pA).
169585	pVH254-Tier1-OTetO7-Pmin-SEAP	Tier-1 vector encoding PTetO7-driven SEAP expression (OTetO7-Pmin-SEAP-pA).
169586	pTS1017-Tier1-OTetO7-PCMVmin-SEAP	Tier-1 vector encoding PTetO7-driven SEAP (OTetO7-PCMVmin-SEAP-pA).
169587	pVH255-Tier1-OTetO7-PCMVmin1-SEAP	Tier-1 vector encoding PTetO7-driven SEAP expression (OTetO7-PCMVmin-1-SEAP-pA).
169588	pVH265-Tier1-OTetO7-PCMVmin2-TS-SEAP	Tier-1 vector encoding PTetO7-driven SEAP expression with a suppressor 5'UTR (OTetO7-PCMVmin-2-5'UTRTS-SEAP-pA).
169589	pVH266-Tier1-OTetO7-PCMVmin2-SEAP-sTRSV	Tier-1 vector encoding PTetO7-driven SEAP expression with a 3'UTR sTRSV ribozyme (OTetO7-PCMVmin-2-SEAP-3'UTRsTRSV-pA).
169590	pVH267-Tier1-OTetO7-PCMVmin2-SEAP-env140	Tier-1 vector encoding PTetO7-driven SEAP expression with a 3'UTR env140 ribozyme (OTetO7-PCMVmin-2-SEAP-3'UTRenv140-pA).
169591	pVH268-Tier1-OTetO7-PCMVmin2-SEAP-p2A-iRFP670	Tier-1 vector encoding PTetO7-driven SEAP-p2A-iRFP670 expression (OTetO7-PCMVmin-2-SEAP-p2A-iRFP670-pA).
169592	pVH270-Tier1-OTtgO2-PCMVmin2-SEAP-p2A-iRFP670	Tier-1 vector encoding PTtgO2-driven SEAP-p2A-iRFP670 expression (OTtgO2-PCMVmin-2-SEAP-p2A-iRFP670-pA).
169594	pVH607-Tier1-PCREm4-Nluc	Tier-1 vector encoding PCREm4-driven Nluc expression (PCREm4-Nluc-pA).
169595	pVH321-1-Tier1-PhCMV-dCas9-3xNLS	Tier-1 vector encoding PhCMV-driven dCas9-3xNLS expression (PhCMV-dCas9-3xNLS-pA).
169596	pVH321-2-Tier1-PhCMV-NLS-dCas9-3xNLS	Tier-1 vector encoding PhCMV-driven NLS-dCas9-3xNLS expression (PhCMV-NLS-dCas9-3xNLS-pA).
169597	pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64	Tier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).
169599	pVH1001-Tier2(ColE1 ori)	Tier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and ColE1 ori).
169600	pVH1002-Tier2(pUC ori)	Tier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and pUC ori).
169602	pVH613	Tier-2 vector encoding PCREm4-driven Nluc and PmPGK1-driven Fluc expression (PCREm4-Nluc-pA::A2-pA::PmPGK1-Fluc-pA).
169603	pVH614	Tier-2 vector encoding PmPGK1-driven Fluc and PCREm4-driven Nluc expression (PmPGK1-Fluc-pA::PCREm4-Nluc-pA::A3-pA).
169604	pVH615	Tier-2 vector encoding PCREm4-driven Nluc and PmPGK1-driven Fluc expression (A1-pA::PCREm4-Nluc-pA::PmPGK1-Fluc-pA).
169605	pVH616	Tier-2 vector encoding PmPGK1-driven Fluc and PCREm4-driven Nluc expression (PmPGK1-Fluc-pA::A2-pA::PCREm4-Nluc-pA).
169606	pVH617	Tier-2 vector encoding PmPGK1-driven Fluc and PCREm4-driven Nluc expression (A1-pA::PmPGK1-Fluc-pA::PCREm4-Nluc-pA).
169607	pVH663	Tier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven tTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-tTA-pA::PmPGK1-YPet-pA).
169608	pVH664	Tier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven rtTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::PmPGK1-YPet-pA).
169610	pVH666	Tier-2 vector encoding PTtgO2-driven SEAP-p2A-iRFP670, PmPGK1-driven TtgA and PmPGK1-driven mRuby2 expression (PTtgO2-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-TtgA-pA::PmPGK1-mRuby2-pA).
169611	pTS1031	Tier-2 vector encoding PhCMV-driven secreted Nluc (PhCMV-IgkSS-Nluc-pA::A2-pA::A3-pA).
169612	pTS1032	Tier-2 vector encoding PhCMV-driven secreted Nluc (A1-pA::PhCMV-IgkSS-Nluc-pA::A3-pA).
169613	pTS1033	Tier-2 vector encoding PhCMV-driven secreted Nluc (A1-pA::A2-pA::PhCMV-IgkSS-Nluc-pA).
169614	pTS1035	Tier-2 vector encoding PmPGK1-driven secreted Nluc (PmPGK1-IgkSS-Nluc-pA::A2-pA::A3-pA).
169615	pTS1036	Tier-2 vector encoding PmPGK1-driven secreted Nluc (A1-pA::PmPGK1-IgkSS-Nluc-pA::A3-pA).
169616	pTS1037	Tier-2 vector encoding PmPGK1-driven secreted Nluc (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-pA).
169617	pTS1039	Tier-2 vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::A3-pA).
169618	pTS1040	Tier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).
169619	pTS1041	Tier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169620	pTS1042	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (PhCMV-SEAP-p2A-iRFP670-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).
169621	pTS1043	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA) .
169622	pTS2312	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169624	pTS2317	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169625	pTS2320	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 preluded by a 5' spacer sequence (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::spacer-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).
169626	pTS2321	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).
169627	pTS2322	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' Tactb insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::Tactb-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).
169628	pTS2326	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).
169629	pTS2329	Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 preluded by a 5' spacer sequence (PhCMV-SEAP-p2A-iRFP670-pA::spacer-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).
169630	pgTS40	pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.
169632	pTS2163	Tier-3 vector for CRISPR-mediated stable integration into the AAVS1 locus of the tetON-system (OTetO7-PCMVmin-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::A3-pA)
169633	pTS395_PhCMV-SB100	Expression vector encoding PhCMV driven SB100 sleeping beauty transposase (PhCMV-SB100-pA)
169634	pTS1107_Tier3(SB)	Tier-3 vector for stable integration of up to three cassettes via sleeping beauty transposase (5'ITR-A1-pA::A2-pA::A3-pA-3'ITR)
169635	pTS2337_Tier3(SB)-TagBFP2_Puro	Tier-3 vector for stable integration of up to three cassettes via sleeping beauty transposase including a TagBFP marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mTagBFP2-p2A-PuroR-pA-3'ITR)
169637	pTS2339_Tier3(SB)-Ruby_Puro	Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a mRuby2 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-PuroR-pA-3'ITR)
169638	pTS2340_Tier3(SB)-iRFP_Puro	Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a iRFP670 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-iRFP670-p2A-PuroR-pA-3'ITR)
169639	pTS2341_Tier3(SB)-Puro	Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR)
169641	pTS2343_Tier3(SB)-YPet_Blast	Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-YPet-p2A-BlastR-pA-3'ITR)
169642	pTS2344_Tier3(SB)-mRuby2_Blast	Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a mRuby marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-BlastR-pA-3'ITR)
169648	pTS2351_Tier3(SB)-Zeo	Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a ZeoR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-ZeoR-pA-3'ITR)
169649	pTS1019_Tier3(PB)	Tier-3 vector for stable integration of up to three cassettes via piggyBac transposase (ITR-A1::A2::A3-ITR)
169652	pTS2353_Tier3(PB)-YPet_PuroR	Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)
169653	pTS2354_Tier3(PB)-Ruby_PuroR	Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a mRuby2 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-PuroR-pA-3'ITR)
169654	pTS2355_Tier3(PB)-iRFP_PuroR	Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a iRFP670 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-iRFP670-p2A-PuroR-pA-3'ITR)
169655	pTS2356_Tier3(PB)-PuroR	Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR)
169656	pTS2357_Tier3(PB)-TagBFP_BlastR	Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a mTagBFP2 marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mTagBFP2-p2A-BlastR-pA-3'ITR)
169657	pTS2361_Tier3(SB)-rtTA-YPet_PuroR	Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)
169658	pTS2362_Tier3(SB)-rtTA-PuroR	Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-PuroR-pA-3'ITR)
169659	pTS2363_Tier3(PB)-rtTA-YPet_PuroR	Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)
169661	pTS1106_Tier3(Lenti)	Tier-3 vector for stable integration of up to three cassettes via lentiviral transduction (PCMV-5'LTR-Psi-gag-env-A1::A2::A3-WPRE-3'LTR)
169663	pTS1108_Tier3(Lenti_inverse)	Tier-3 vector for stable integration of up to three cassettes via lentiviral transduction in inverted direction with polyA (PCMV-5'LTR-Psi-gag-env-A3-pA::A2-pA::A1-pA-WPRE-3'LTR)
169664	pTS2333_Tier3(Lenti_inverse)-YPet_Puro	Tier-3 vector for stable integration via lentiviral transduction in inverted direction with polyA carrying a constitutive expression cassette for puromyine and Ypet (PCMV-5'LTR-Psi-gag-env-PRPBSA-YPet-p2A-PuroR-pA::A2-pA::A3-pA-WPRE-3'LTR)
169665	pTS2334_Tier3(Lenti_inverse)-rtTA-YPet_Puro	Tier-3 vector for lentiviral stable integration of the rtTA and puromyine - Ypet selection cassette in inverted direction with polyA (PRPBSA-YPet-p2a-PuroR::PPGK-rtTA-pA::A3-pA)
169667	pVH269-Tier1-OVanO2-PCMVmin2-SEAP-p2A-iRFP670	Tier-1 vector encoding PVanO2-driven SEAP-p2A-iRFP670 expression (OVanO2-PCMVmin-2-SEAP-p2A-iRFP670-pA).