Rapid Self-Selecting and Clone-Free Integration of Transgenes into Engineered CRISPR Safe Harbor Locations in Caenorhabditis elegans.
Stevenson ZC, Moerdyk-Schauwecker MJ, Jamison B, Phillips PC
G3 (Bethesda). 2020 Aug 19. pii: g3.120.401400. doi: 10.1534/g3.120.401400.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 154824 | pZCS16 (Peft-3::wrmScarlet::tbb-2 3'UTR in pUC19) | (eft-3p::wrmScarlet::tbb-2 3'UTR in pUC19) Experimentally used to mark formation of transgenic arrays for C. elegans |
| 154837 | pMS4 (Empty insertion vector with SEC) | Vector that can be modified to add gene(s) of interest to C. elegans ChrII:8420157 site via CRISPR with SEC selection |
| 154838 | pMS74 (synthetic guide::∆HYGR::unc-54 3' UTR^SEC) | Insertion of split hygromycin landing pad into ChrII:8420157 site C. elegans strains via CRISPR with SEC selection |
| 154839 | pMS79 (eft-3p::Cas9 + sgRNA) | Cas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGG |
| 154840 | pMS81(rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆) | Insertion of rpl-28p::mKate2::unc-54 3'UTR into a split hygromycin landing pad. Can be modified to insert a different gene(s) of interest. |