Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Structure-Mediated RNA Decay by UPF1 and G3BP1.

Fischer JW, Busa VF, Shao Y, Leung AKL
Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi: 10.1016/j.molcel.2020.01.021. Epub 2020 Feb 3. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
135994pci-EGFP-UPF1-WTWT UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135995pci-EGFP-UPF1-R615AR615A UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135996pci-EGFP-UPF1-DEAADEAA UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135997pEGFP-C1-G3BP1-WTWT G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135998pEGFP-C1-G3BP1-S149AS149A G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135999pEGFP-C1-G3BP1-DeltaRBPG3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminus
136000pcDNA5 FRT-TO-EGFP-UPF1-WTDOX-inducible WT UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136001pcDNA5 FRT-TO-EGFP-UPF1-R615ADOX-inducible R615A UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136002pcDNA5 FRT-TO-EGFP-UPF1-DEAADOX-inducible DEAA UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136003pcDNA5 FRT TO-EGFP-G3BP1-WTDOX-inducible WT G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136004pcDNA5 FRT TO-EGFP-G3BP1-S149ADOX-inducible S149A G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136005pcDNA5 FRT TO-EGFP-G3BP1-DeltaRBPDOX-inducible G3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136006pCI-neo-lambdaN-UPF1-WTWT UPF1 inserted with lambdaN tagged on the N-terminus to use with the Tethering Assay (BoxB)
136007pCI-neo-lambdaN-UPF1-DEAADEAA UPF1 inserted with lambdaN tagged on the N-terminus to use with the Tethering Assay (BoxB)
136008pCI-neo-His-MS2BP-G3BP1-WTWT G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)
136009pCI-neo-His-MS2BP-G3BP1-S149AS149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)
136010psi-CHECK3psi-CHECK2 plasmid modified so both Renilla and Firefly luciferase contain introns
136011psi-CHECK3-3xBoxB-MS23 repeats of BoxB and MS2 hairpins inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid for the Tethering assay
136012psiCHECK3-EIF3BEIF3B 3'UTR (NM_001037283.1) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136013psiCHECK3-SDHAF3SDHAF3 3'UTR (NM_020186.2) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136014psiCHECK3-TMED3TMED3 3'UTR (NM_007364.3) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136015psiCHECK3-ZC3H15ZC3H15 3'UTR (NM_018471.2) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136016psiCHECK3-EIF3B-Reverse-ComplementThe Reverse Complement of EIF3B 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136018psiCHECK3-TMED3-Reverse-ComplementThe Reverse Complement of TMED3 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136019psiCHECK3-ZC3H15-Reverse-ComplementThe Reverse Complement of ZC3H15 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136020psiCHECK3-EIF3B-1-147EIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136021psiCHECK3-EIF3B-148-464EIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136022psiCHECK3-EIF3B-465-552EIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136023psiCHECK3-EIF3B-1-464EIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136024psiCHECK3-EIF3B-148-552EIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136025psiCHECK3-UnstructuredArtificial Unstructured 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136026psiCHECK3-EIF3B-UnstructuredEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136027psiCHECK3-Unstructured-EIF3BEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136028psiCHECK3-EIF3B-465-552-UnstructuredEIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136029psiCHECK3-Unstructured-EIF3B-465-552EIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136030psiCHECK3-EIF3B-88nt-Delta-HairpinEIF3B (465-552) 3'UTR with the main hairpin deleted inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136031psiCHECK3-EIF3B-88nt-1st-HairpinEIF3B (465-552) 3'UTR with only the main hairpin inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136032psiCHECK3-EIF3B-88nt-Disrupted-HairpinEIF3B (465-552) 3'UTR with the main hairpin mutated inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136033psiCHECK3-EIF3B-88nt-Restored-HairpinEIF3B (465-552) 3'UTR with the main hairpin restored inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136034psiCHECK3-EIF3B-88nt-A:U-HairpinEIF3B (465-552) 3'UTR with the main hairpin mutated to A and U nucleotides only inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136035PLKO.1-ScrambledScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)
136036PLKO.1-UPF1-3'UTRUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)
136037PLKO.1-UPF1-CDSUPF1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (AAGACACCTATTACACGAAGG)
136038PLKO.1-G3BP1-3'UTRG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)
136039PLKO.1-G3BP1-CDSG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)
136040PLKO.1-UPF2-CDSUPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA)
136041PLKO.1-UPF2-3'UTRUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)
136042PLKO.1-UPF3A-3'UTRUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)
136043PLKO.1-UPF3A-CDSUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)
136044PLKO.1-UPF3B-3'UTRUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)
136045PLKO.1-UPF3B-CDSUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)
136046PLKO.1-SMG6-CDS-1SMG6 shRNA (Targeting CDS #1) inserted into the PLKO.1 plasmid (AACTTGTAAGTAACCTGCAGC)
136047PLKO.1-SMG6-CDS-2SMG6 shRNA (Targeting CDS #2) inserted into the PLKO.1 plasmid (AAGGAGTTCCAGGTGTTACTG)
136048PLKO.1-STAU1-CDSSTAU1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGAGTAAAGCCTAGAATCAAA)
136049PLKO.1-STAU1-3'UTRSTAU1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CCATCACCACTGCTTTCTCTT)
136050PLKO.1-STAU2-CDSSTAU2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GATATGAACCAACCTTCAA)
136051PLKO.1-STAU2-3'UTRSTAU2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCAGGTAGTTGTTAGTGTTT)
136052PLKO.1-REG1-3'UTRREG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG)
136053PLKO.1-REG1-CDSREG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)
136054PLKO.1-CAPRIN1-CDSCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)
136055PLKO.1-CAPRIN1-3'UTRCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)
136056PLKO.1-USP10-3'UTRUSP10 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTCTCTTTAGTGGCTCTTT)
136057PLKO.1-USP10-CDSUSP10 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTATGTGGAAACTAAGTATT)
136058pSpCas9(BB)-2A-GFP-G3BP1(1)G3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)
136059pSpCas9(BB)-2A-GFP-G3BP1(2)G3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)
136060pSpCas9(BB)-2A-GFP-G3BP2(1)G3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)
136061pSpCas9(BB)-2A-GFP-G3BP2(2)G3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)

Antibodies from Article