Rapid Generation of Human Neuronal Cell Models Enabling Inducible Expression of Proteins-of-interest for Functional Studies.
Wang X, Friesen E, Muller I, Lemieux M, Dukart R, Maia IB, Kalia S, Schmitt-Ulms G
Bio Protoc. 2020 May 5;10(9):e3615. doi: 10.21769/BioProtoc.3615. eCollection 2020 May 5.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 132388 | AAVS1 KanR foundation lox casette | Foundation cassette containing lox sites for cre-mediated exchange of inducible vectors, confers mammalian G418 resistance, targets AAVS1 locus |
| 132389 | AAVS1 CAG rtTA3 TauWT 2N4R-EGFP | Exchange cassette containing inducible TauWT 2N4R-EGFP fusion, CAG-driven rtTA3, Puromycin resistance marker, targets AAVS1 site |
| 132393 | AAVS1 CAG rtTA3 TauP301L 2N4R-EGFP | Exchange cassette containing inducible TauP301L 2N4R-EGFP fusion, CAG-driven rtTA3, Puromycin resistance marker, targets AAVS1 site |
| 132394 | AAVS1 intron 1 gRNA as2 | Targets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backbone |
| 132395 | AAVS1 intron 1 gRNA s3 | Targets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backbone |
| 132396 | AAVS1 intron 1 gRNA 27 | Targets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backbone |