Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis.
Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M
iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 115178 | pENTR223-PARK7V51G | Gateway cloning of PARK7V51G into any destination vector |
| 115179 | pENTR223-PARK7C53A | Gateway cloning of PARK7C53G into any destination vector |
| 115180 | pENTR223-PARK7H126A | Gateway cloning of PARK7H126A into any destination vector |
| 115181 | pENTR223-PARK7E163K | Gateway cloning of PARK7E163K into any destination vector |
| 115182 | pLD-puro-Cc-PARK7WT-VA | Lentiviral transduction and expression of PARK7WT into any mammalian cell |
| 115183 | pLD-puro-Cc-PARK7V51G-VA | Lentiviral transduction and expression of PARK7V51G into any mammalian cell |
| 115184 | pLD-puro-Cc-PARK7C53A-VA | Lentiviral transduction and expression of PARK7C53A into any mammalian cell |
| 115185 | pLD-puro-Cc-PARK7H126A-VA | Lentiviral transduction and expression of PARK7H126A into any mammalian cell |
| 115186 | pLD-puro-Cc-PARK7E163K-VA | Lentiviral transduction and expression of PARK7E163K into any mammalian cell |
| 115187 | pLD-puro-Cc-CR-PARK7WT-VA | Lentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg) |
| 115188 | pLD-puro-Cc-CR-PARK7V51G-VA | Lentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg) |
| 115189 | pLD-puro-Cc-CR-PARK7C53A-VA | Lentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg) |
| 115190 | pLD-puro-Cc-CR-PARK7H126A-VA | Lentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg) |
| 115191 | pLD-puro-Cc-CR-PARK7E163K-VA | Lentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg) |
| 115192 | pLEX307_PDHA2 | Lentiviral transduction and expression of PDHA2 into any mammalian cell |
| 115196 | pLEX307_PDHA2S291A | Lentiviral transduction and expression of PDHA2S291A into any mammalian cell |
| 115197 | pLEX307_PDHA2S293A | Lentiviral transduction and expression of PDHA2S293A into any mammalian cell |
| 115198 | pLEX307_PDHA2S291A/S293A | Lentiviral transduction and expression of PDHA2S291A/S293A into any mammalian cell |
| 115199 | pLEX307_CR-PDHA2 | Lentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3') |
| 115203 | pLEX307_CR-PDHA2S291A | Lentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3') |
| 115204 | pLEX307_CR-PDHA2S293A | Lentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3') |
| 115205 | pLEX307_CR-PDHA2S291A/S293A | Lentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3') |
| 128507 | pPHAGE-EF1α-Luc-C20orf24-3’UTR-VAR | Lentiviral constitutive expression of Firefly luciferase under control of 3'UTR of human C20orf24 with variant from COX deficiency patient. |
| 128508 | pPHAGE-C20orf24- C20orf24-3’UTR-WT | Lentiviral constitutive expression of C20orf24 under control of its native WT 3'UTR of human C20orf24. |
| 128509 | pPHAGE-C20orf24- C20orf24-3’UTR-VAR | Lentiviral constitutive expression of C20orf24 under control of its native 3'UTR of human C20orf24 with variant from COX deficiency patient. |
| 128510 | pPHAGE-CR-PINK1-C-TAP | Lentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag. |
| 128511 | pPHAGE-CR-NENF-C-TAP | Lentiviral constitutive expression of CRISPR-resistant NENF with c-terminal FLAG and HA tag. |
| 128551 | pPHAGE-EF1α-Luc-C20orf24-3’UTR-WT | Lentiviral constitutive expression of Firefly luciferase under control of WT 3'UTR of human C20orf24. |