Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Differential effects of GLI2 and GLI3 in regulating cervical cancer malignancy in vitro and in vivo.

Zhu H, Xia L, Shen Q, Zhao M, Gu X, Bouamar H, Wang B, Sun LZ, Zhu X
Lab Invest. 2018 Nov;98(11):1384-1396. doi: 10.1038/s41374-018-0089-5. Epub 2018 Jul 2. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
136691pTet-GLI2shRInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)
136693pTet-ctlControl for pTet-Gli2shR

Antibodies from Article