Skip to main content
Addgene

Differential effects of GLI2 and GLI3 in regulating cervical cancer malignancy in vitro and in vivo.

Zhu H, Xia L, Shen Q, Zhao M, Gu X, Bouamar H, Wang B, Sun LZ, Zhu X
Lab Invest. 2018 Nov;98(11):1384-1396. doi: 10.1038/s41374-018-0089-5. Epub 2018 Jul 2. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
136691pTet-GLI2shRInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)
136693pTet-ctlControl for pTet-Gli2shR

Antibodies from Article