Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Poly(Beta-Amino Ester) Nanoparticles Enable Nonviral Delivery of CRISPR-Cas9 Plasmids for Gene Knockout and Gene Deletion.

Rui Y, Varanasi M, Mendes S, Yamagata HM, Wilson DR, Green JJ
Mol Ther Nucleic Acids. 2020 Apr 21;20:661-672. doi: 10.1016/j.omtn.2020.04.005. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
113966sg1Single short guide RNA targeting GTATAGCATACATTATACG
113967sg2Single short guide RNA targeting TACCACATTTGTAGAGGTT
113968sg3Single short guide RNA targeting CAATGTATCTTATCATGTC
113969sg1+sg2+sg3Triple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTC
113970sg2+sg3Double short guide RNA targeting TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTC
113972sgiRFP1Single short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequence
113973sgiRFP2Single short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequence
113974sgiRFP3Single short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequence
127197pGTRmpGTRm is the template plasmid for PCR & golden gate assembly driven generation of polycistronic tRNA-gRNA sequences
127198PTGSingle template U6 promoter minimal size plasmid
127199pPTG-GG-sg2+sg3Plasmid expressing sgRNA2 (TACCACATTTGTAGAGGTT) & sgRNA3 (CAATGTATCTTATCATGTC) as polycistronic tRNA-gRNA from single U6 promoter

Antibodies from Article