Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Sandra Martha Gomes Dias Lab: HuR (ELAVL1) silencing sensitizes triple-negative breast cancer to glutaminase-targeted therapy

Sandra Martha Gomes Dias
Unpublished

Plasmids from Article

ID Plasmid Purpose
110386pQC V5 HuR.wt IRES Puroγ-Retroviral transfer vector for expressing HuR (wild type), IRES-driven Puromycin selection.
110387pQC V5 mKO2 HuR.wt IRES Puroγ-Retroviral transfer vector for expressing HuR (wild type), V5 and mKO2 tags, IRES-driven Puromycin selection.
110389pQC V5 mKO2 HuR.DelHNS IRES Puroγ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection.
110390pQC hKGA.wt V5-His IRES G418γ-Retroviral transfer vector for expressing glutminase isoform KGA (wild type), C-terminal V5-6xHis tags, IRES-driven Geneticin selection.
110391pQC hKGA.S286A V5-His IRES G418γ-Retroviral transfer vector for expressing glutminase isoform KGA (S286A), C-terminal V5-6xHis tags, IRES-driven Geneticin selection.
110401psiCHECK2 3'UTR GACLuminescence-based glutaminase GAC isoform 3'UTR-mediated RNA stability reporter
110402psiCHECK2 3'UTR KGALuminescence-based glutaminase KGA isoform 3'UTR-mediated RNA stability reporter
110403pX330.puroCRISPR/Cas9 vector with sgRNA expression and puromycin resistance
110404pX330.orupCRISPR/Cas9 vector with sgRNA expression and puromycin resistance
110405pX330.puro sgRNA KGA Stop1CRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistance
110406pUC19 KGA HA5'-mKO2-3'Homology donor for glutaminase KGA isoform knock-in, mKO2
110408pUC19 KGA HA5'-mKO2-P2A-Zeo-3'Homology donor for glutaminase KGA isoform knock-in, mKO2-P2A-Zeo
110409pLKO.1-blast shLucshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.
110410pLKO.1-blast shGACshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.
110411tet-pLKO.puro_shHuR CDSTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selection
110412tet-pLKO.puro_shHuR 3UTRTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selection
110414pLKO.puro_shHuR 3UTRTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selection

Antibodies from Article