Sandra Martha Gomes Dias Lab: HuR (ELAVL1) silencing sensitizes triple-negative breast cancer to glutaminase-targeted therapy
Sandra Martha Gomes Dias
Unpublished
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 110386 | pQC V5 HuR.wt IRES Puro | γ-Retroviral transfer vector for expressing HuR (wild type), IRES-driven Puromycin selection. |
| 110387 | pQC V5 mKO2 HuR.wt IRES Puro | γ-Retroviral transfer vector for expressing HuR (wild type), V5 and mKO2 tags, IRES-driven Puromycin selection. |
| 110389 | pQC V5 mKO2 HuR.DelHNS IRES Puro | γ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection. |
| 110390 | pQC hKGA.wt V5-His IRES G418 | γ-Retroviral transfer vector for expressing glutminase isoform KGA (wild type), C-terminal V5-6xHis tags, IRES-driven Geneticin selection. |
| 110391 | pQC hKGA.S286A V5-His IRES G418 | γ-Retroviral transfer vector for expressing glutminase isoform KGA (S286A), C-terminal V5-6xHis tags, IRES-driven Geneticin selection. |
| 110401 | psiCHECK2 3'UTR GAC | Luminescence-based glutaminase GAC isoform 3'UTR-mediated RNA stability reporter |
| 110402 | psiCHECK2 3'UTR KGA | Luminescence-based glutaminase KGA isoform 3'UTR-mediated RNA stability reporter |
| 110403 | pX330.puro | CRISPR/Cas9 vector with sgRNA expression and puromycin resistance |
| 110404 | pX330.orup | CRISPR/Cas9 vector with sgRNA expression and puromycin resistance |
| 110405 | pX330.puro sgRNA KGA Stop1 | CRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistance |
| 110406 | pUC19 KGA HA5'-mKO2-3' | Homology donor for glutaminase KGA isoform knock-in, mKO2 |
| 110408 | pUC19 KGA HA5'-mKO2-P2A-Zeo-3' | Homology donor for glutaminase KGA isoform knock-in, mKO2-P2A-Zeo |
| 110409 | pLKO.1-blast shLuc | shLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection. |
| 110410 | pLKO.1-blast shGAC | shGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection. |
| 110411 | tet-pLKO.puro_shHuR CDS | TRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selection |
| 110412 | tet-pLKO.puro_shHuR 3UTR | TRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selection |
| 110414 | pLKO.puro_shHuR 3UTR | TRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selection |