53BP1 can limit sister-chromatid rupture and rearrangements driven by a distinct ultrafine DNA bridging-breakage process.
Tiwari A, Addis Jones O, Chan KL
Nat Commun. 2018 Feb 14;9(1):677. doi: 10.1038/s41467-018-03098-y.
(Link opens in a new window)
PubMed
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 110301 | pEGFP-h53BP1 (siRNA resistant) | Mammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG) |
| 110302 | pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D | Expresssion of Cas9-T2A-puromycin resistant gene and a gRNA targeting exon 10 of human 53BP1 |