Intron-containing RNA from the HIV-1 provirus activates type I interferon and inflammatory cytokines.
McCauley SM, Kim K, Nowosielska A, Dauphin A, Yurkovetskiy L, Diehl WE, Luban J
Nat Commun. 2018 Dec 13;9(1):5305. doi: 10.1038/s41467-018-07753-2.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 74168 | pAIP hGMCSF co | Lentiviral vector for expression of human codon optimized GMCSF with puromycin resistance. |
| 74169 | pAIP hIL4 co | Lentiviral vector for expression of human codon optimized IL4 with puromycin resistance. |
| 90513 | pAIP hIL2 co | Lentiviral vector for expression of human codon optimized IL2 with puromycin resistance. |
| 101323 | pALPS eGFP | Encodes eGFP |
| 101324 | pALPS gag | Encodes codon optimized NL4-3 gag |
| 101325 | pALPS env | Encodes codon optimized JR-CSF env |
| 101326 | pALPS tat | Encodes codon optimized NL4-3 tat |
| 101327 | pALPS rev | Encodes codon optimized NL4-3 rev |
| 101328 | pALPS vif | Encodes codon optimized NL4-3 vif |
| 101329 | pALPS vpr | Encodes codon optimized NL4-3 vpr |
| 101330 | pALPS vpu | Encodes codon optimized NL4-3 vpu |
| 101331 | pALPS tat-P2A-rev | Lentivector expressing codon optimized NL4-3 tat and rev linked by P2A peptide coding sequence (GSGATNFSLLKQAGDVEENPGP) |
| 101332 | pBS NL4-3 envFS eGFP RT-D185K/D186L | pBS NL4-3 envFS eGFP with mutation that disrupts RT catalytic activity |
| 101333 | pBS NL4-3 envFS eGFP IN-D116A | pBS NL4-3 envFS eGFP with mutation that disrupts IN catalytic activity |
| 101334 | pBS NL4-3 envFS eGFP PR-D25A | pBS NL4-3 envFS eGFP with mutation that disrupts Protease catalytic activity |
| 101335 | pALPS puro miR30-L1221 | negative control for knockdowns target site: CTTGTCGATGAGAGCGTTTGT |
| 101336 | pALPS puro miR30-IRF3 | target site ATCAGATCTACAATGAAGGGC |
| 101337 | pALPS_3'LTR GFP@gag start SFFV- | Repaired U3 allows LTR-based transcription by the provirus with GFP as a marker for expression. WPRE was deleted. |
| 101338 | pALPS_3'LTR GFP@gag start SFFV tat | LTR drives GFP and internal SFFV promoter drives codon optimized tat |
| 101339 | pALPS_3'LTR GFP@gag start SFFV rev | LTR drives GFP and internal SFFV promoter drives codon optimized rev |
| 101340 | pALPS_3'LTR GFP@gag start SFFV tat-P2A-rev | LTR drives GFP and internal SFFV promoter drives codon optimized tat and rev. |
| 101341 | pNL4-3 envFS eGFP gag2xFS | 1st frameshift is CG nucleotide insertion in MA at nt 832. 2nd is a CTAG addition in CA at nt 1508. |
| 101342 | pNL4-3 envFS eGFP NoStarts | All ATGs from the start of gag to NC mutated to ATC except the first which was mutated to ACG |
| 101343 | pBS NL4-3 envFS eGFP Δgag/pol | Deletion from the start of gag until 229 bases before the cPPT |
| 101344 | pNL4-3 envFS eGFP Δvif/vpr | Deletion from NL4-3 nt 5582-6199 encompassing Vif and Vpr coding sequence |
| 101345 | pNL4-3 envFS eGFP Δvpu/env | Deletion from NL4-3 nt 6054-7489 encompassing all of vpu and env until before the RRE |
| 101346 | pBS NL4-3 envFS eGFP Δnef/U3 | Deletion from NL4-3 nt 8911-9022 and 9088-9377. This deletes nef and U3 LTR sequences |
| 101347 | pBS NL4-3 envFS eGFP 5'CMV Δtat | tat ATG->ACG (silent in vpr reading frame), nt 78 mutated T->G to change Tyr to stop codon, nt 116 mutated T->C to disrupt Met, 5'LTR replaced with CMV-R-U5 from pALPS for tat-independent transcription in HEK293E cells. |
| 101348 | pBS NL4-3 envFS eGFP Δrev | All mutations in rev are silent with respect to the tat reading frame. Start ATG->ACG and nts 68-71 were mutated AGC->TCA to change tyrosine to a stop. |
| 101349 | pBS NL4-3 envFS eGFP 5'CMV Δtat ΔTARx2_d2TetOp | 2xTet Operator inserted between NFkB and Sp1 sites in U3 of HIV-1 delta tat with 5' CMV-R-U5. 5' and 3' TAR elements were mutated to: 5'-GGTCTCTCTGGTTAGACCAGAAAGGAGCATTGGAGCTCTCTGGCTAACTAGGGAACCC-3 |
| 101350 | pALPS rtTA3_V14 | Codon optimized rtTA3 used in trans with Tet inducible HIV-1 |
| 101351 | pSC101 NL4-3 envFS Δrev ΔRRE RTEm26CTE | HIV-1 delta Rev was cloned into pSC101 and modified to include an RTEm26CTE element in order to utilize the NXF1 RNA export pathway. The RRE was also mutated. |
| 117156 | pALPS puro miR30-IRF1 | Target site TTGCTCTTAGCATCTCGGCTG |
| 117157 | pALPS puro miR30-IRF5 | Target site TATTTCCCTGTCTCCTTGGCC |
| 117158 | pALPS puro miR30-IRF7 | Target site ATAAGGAAGCACTCGATGTCG |
| 117159 | pALPS puro miR30-IRF9 | Target site AATTATCACAAAGAGGACAGG |
| 117160 | pALPS puro miR30-STAT1 | Target site ATATCCAGTTCCTTTAGGGCC |
| 117161 | pALPS puro miR30-STAT2 | Target site TTTAAGTTCCACAGACTTGGA |
| 117162 | pALPS puro miR30-TAK1 | Target site AGCGCCCTTCAATGGAGGAAAT |