Shelley Copley Lab Materials

The Shelley Copley Lab has deposited materials at Addgene for distribution to the research community. Addgene is a nonprofit plasmid repository dedicated to improving life science research.

Learn more about research in the Shelley Copley Lab.

If this is your lab: Add a depositor badge to your website.

• Plasmids
• Articles

Showing 1 to 2 of 2 entries

Show 102550100All entries

Search table:

• Previous
• 1
• Next

Title	Authors	Publication
A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica.	Kim J, Webb AM, Kershner JP, Blaskowski S, Copley SD	BMC Biotechnol. 2014 Sep 25;14(1):84.
Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness.	Yang DD, Rusch LM, Widney KA, Morgenthaler AB, Copley SD	Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22.

Showing 1 to 10 of 10 entries

Show 102550100All entries

Search table:

• Previous
• 1
• Next

	ID	Plasmid	Gene/Insert	Vector Type	Publication
100.4.397921.59386	59386	pSLTS		Bacterial Expression	A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica. BMC Biotechnol. 2014 Sep 25;14(1):84.
20.44.534710.59384	59384	pT2ST	TT-ISceI-dfrA		A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica. BMC Biotechnol. 2014 Sep 25;14(1):84.
20.0.696442.59382	59382	pT2SC	TT-ISceI-cat		A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica. BMC Biotechnol. 2014 Sep 25;14(1):84.
20.0.689828.59383	59383	pT2SK	TT-ISceI-kan		A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica. BMC Biotechnol. 2014 Sep 25;14(1):84.
	59385	pT2SCb	TT-ISceI-cat2		A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica. BMC Biotechnol. 2014 Sep 25;14(1):84.
	182958	pDY118A	Cas9, Gam, Beta, Exo, I-scel		Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness. Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22.
	182959	pDY279	gRNA (ttcaggcattttagcatccc), homologous repair template for ptsI	Bacterial Expression, Synthetic Biology	Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness. Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22.
	182960	pDY281	gRNA (acctggtgaagccaatattc), homologous repair template for ptsI	Bacterial Expression, Synthetic Biology	Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness. Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22.
	182962	pDY380	ptsI	Synthetic Biology	Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness. Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22.
	182963	pDY390	ptsI	Synthetic Biology	Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness. Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22.