pHR-TRE3G-NLS-tdMCP-mCherry
(Plasmid
#99909)
-
PurposeFor the expression of NLS-tdMCP-mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99909 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-tdMCP-mCherry
-
SpeciesSynthetic
- Promoter TRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer gtgtacggtgggaggcctatataa
- 3′ sequencing primer caaaggcattaaagcagcgtatccac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-TRE3G-NLS-tdMCP-mCherry was a gift from Yujie Sun (Addgene plasmid # 99909 ; http://n2t.net/addgene:99909 ; RRID:Addgene_99909) -
For your References section:
Long-term dual-color tracking of genomic loci by modified sgRNAs of the CRISPR/Cas9 system. Shao S, Zhang W, Hu H, Xue B, Qin J, Sun C, Sun Y, Wei W, Sun Y. Nucleic Acids Res. 2016 May 19;44(9):e86. doi: 10.1093/nar/gkw066. Epub 2016 Feb 4. 10.1093/nar/gkw066 PubMed 26850639