Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR-TRE3G-NLS-tdMCP-mCherry
(Plasmid #99909)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99909 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-tdMCP-mCherry
  • Species
    Synthetic
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer gtgtacggtgggaggcctatataa
  • 3′ sequencing primer caaaggcattaaagcagcgtatccac
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-TRE3G-NLS-tdMCP-mCherry was a gift from Yujie Sun (Addgene plasmid # 99909 ; http://n2t.net/addgene:99909 ; RRID:Addgene_99909)
  • For your References section:

    Long-term dual-color tracking of genomic loci by modified sgRNAs of the CRISPR/Cas9 system. Shao S, Zhang W, Hu H, Xue B, Qin J, Sun C, Sun Y, Wei W, Sun Y. Nucleic Acids Res. 2016 May 19;44(9):e86. doi: 10.1093/nar/gkw066. Epub 2016 Feb 4. 10.1093/nar/gkw066 PubMed 26850639