pFUS_A8
(Plasmid
#99882)
-
Purpose(Empty Backbone) Recipient vector for Golden Gate TALE cloning system. Used to assemble 8 TALE repeats.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFUS_A
-
Vector typeTALEN
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ttgatgcctggcagttccct
- 3′ sequencing primer cgaaccgaacaggcttatgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The BsaI cuting sites were modified to receive 8 TALE repeats for Golden Gate Assembly
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUS_A8 was a gift from Yiping Qi (Addgene plasmid # 99882 ; http://n2t.net/addgene:99882 ; RRID:Addgene_99882) -
For your References section:
Robust transcriptional activation in plants using multiplexed CRISPR-Act2.0 and mTALE-Act systems. Lowder LG, Zhou J, Zhang Y, Malzahn A, Zhong Z, Hsieh TF, Voytas DF, Zhang Y, Qi Y. Mol Plant. 2017 Nov 29. pii: S1674-2052(17)30344-1. doi: 10.1016/j.molp.2017.11.010. 10.1016/j.molp.2017.11.010 PubMed 29197638