Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EKARdual
(Plasmid #99870)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99870 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTriEx4
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EKAR
  • Alt name
    Erk activity reporter
  • Species
    Synthetic
  • Promoter CMV
  • Tags / Fusion Proteins
    • mTFP1 (N terminal on backbone)
    • ShadowG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer T7: taatacgactcactataggg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EKARdual was a gift from Marc Tramier (Addgene plasmid # 99870 ; http://n2t.net/addgene:99870 ; RRID:Addgene_99870)
  • For your References section:

    Multiplexing PKA and ERK1&2 kinases FRET biosensors in living cells using single excitation wavelength dual colour FLIM. Demeautis C, Sipieter F, Roul J, Chapuis C, Padilla-Parra S, Riquet FB, Tramier M. Sci Rep. 2017 Jan 20;7:41026. doi: 10.1038/srep41026. 10.1038/srep41026 PubMed 28106114