pmTFP1-ShadowG
(Plasmid
#99867)
-
PurposeMeasure FRET between mTFP1 and ShadowG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmTFP1-C
-
Backbone manufacturerAllele
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameShadowG
- Promoter CMV
-
Tag
/ Fusion Protein
- mTFP1 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer pEGFP_Rev: TTTAAAGCAAGTAAAACCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmTFP1-ShadowG was a gift from Marc Tramier (Addgene plasmid # 99867 ; http://n2t.net/addgene:99867 ; RRID:Addgene_99867) -
For your References section:
Multiplexing PKA and ERK1&2 kinases FRET biosensors in living cells using single excitation wavelength dual colour FLIM. Demeautis C, Sipieter F, Roul J, Chapuis C, Padilla-Parra S, Riquet FB, Tramier M. Sci Rep. 2017 Jan 20;7:41026. doi: 10.1038/srep41026. 10.1038/srep41026 PubMed 28106114