pcDNA4 h-Stx3 resistant to shRNA #304-2xMyc/His
(Plasmid
#99746)
-
PurposeExpresses human Stx3 with a C-term myc-myc-his that is resistant to shRNA #304 from Sigma Aldrich.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA4
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 5075
- Total vector size (bp) 5909
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameStx3
-
Alt nameStx3A
-
Alt nameStx3 isoform 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)834
-
MutationMade six (6) silent mutations to confer resistance to shRNA #304.
-
GenBank IDNM_004177.4
-
Entrez GeneSTX3 (a.k.a. DIAR12, MVID2, RDMVID, STX3A)
- Promoter CMV/TO
-
Tag
/ Fusion Protein
- myc-myc-his (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer acgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgaggctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4 h-Stx3 resistant to shRNA #304-2xMyc/His was a gift from Thomas Weimbs (Addgene plasmid # 99746 ; http://n2t.net/addgene:99746 ; RRID:Addgene_99746) -
For your References section:
Monoubiquitination of syntaxin 3 leads to retrieval from the basolateral plasma membrane and facilitates cargo recruitment to exosomes. Giovannone AJ, Reales E, Bhattaram P, Fraile-Ramos A, Weimbs T. Mol Biol Cell. 2017 Oct 15;28(21):2843-2853. doi: 10.1091/mbc.E17-07-0461. Epub 2017 Aug 16. 10.1091/mbc.E17-07-0461 PubMed 28814500