pcDNA4/TO h-Stx3S-2xMyc/His
(Plasmid
#99744)
-
PurposeExpresses human Stx3S with a C-term myc-myc-his tag in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA4
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 5075
- Total vector size (bp) 5909
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameStx3S
-
Alt nameStx3 isoform 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)834
-
GenBank IDNM_001178040.1
-
Entrez GeneSTX3 (a.k.a. DIAR12, MVID2, RDMVID, STX3A)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-myc-his (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer acgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgaggctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4/TO h-Stx3S-2xMyc/His was a gift from Thomas Weimbs (Addgene plasmid # 99744 ; http://n2t.net/addgene:99744 ; RRID:Addgene_99744) -
For your References section:
Soluble syntaxin 3 functions as a transcriptional regulator. Giovannone AJ, Winterstein C, Bhattaram P, Reales E, Low SH, Baggs JE, Xu M, Lalli MA, Hogenesch JB, Weimbs T. J Biol Chem. 2018 Apr 13;293(15):5478-5491. doi: 10.1074/jbc.RA117.000874. Epub 2018 Feb 23. 10.1074/jbc.RA117.000874 PubMed 29475951