Icam 2 SaCas9 YAP sgRNA3
(Plasmid #99736)

• Purpose: Expresses SaCas9 and a gRNA targeting mouse YAP
• Depositing Lab: Yu Huang
• Publication: Wang et al Nature. 2016 Dec 7. doi: 10.1038/nature20602.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
• Backbone manufacturer: Feng Zhang Lab (Addgene #61591)
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SaCas9 gRNA targeting Yap1
• Alt name: SaCas9 gRNA targeting yes-associated protein 1
• gRNA/shRNA sequence: CCAGAGACAACGCCACTGGCT
• Species: M. musculus (mouse)
• Entrez Gene: Yap1 (a.k.a. Yap, Yap65, Yki, Yorkie)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: LKO.1 5'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry