Icam 2 SaCas9 YAP sgRNA2
(Plasmid
#99735)
-
PurposeExpresses SaCas9 and a gRNA targeting mouse YAP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591)
-
Backbone manufacturerFeng Zhang Lab
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSaCas9 gRNA targeting Yap1
-
Alt nameSaCas9 gRNA targeting yes-associated protein 1
-
gRNA/shRNA sequenceTGCACGACCTGGTGGCCGGCC
-
SpeciesM. musculus (mouse)
-
Entrez GeneYap1 (a.k.a. Yap, Yap65, Yki, Yorkie)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Icam 2 SaCas9 YAP sgRNA2 was a gift from Yu Huang (Addgene plasmid # 99735 ; http://n2t.net/addgene:99735 ; RRID:Addgene_99735) -
For your References section:
Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Wang L, Luo JY, Li B, Tian XY, Chen LJ, Huang Y, Liu J, Deng D, Lau CW, Wan S, Ai D, Mak KK, Tong KK, Kwan KM, Wang N, Chiu JJ, Zhu Y, Huang Y. Nature. 2016 Dec 7. doi: 10.1038/nature20602. 10.1038/nature20602 PubMed 27926730