Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Icam 2 SaCas9 YAP sgRNA1
(Plasmid #99734)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99734 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591)
  • Backbone manufacturer
    Feng Zhang Lab
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SaCas9 gRNA targeting Yap1
  • Alt name
    SaCas9 gRNA targeting yes-associated protein 1
  • gRNA/shRNA sequence
    TCTGAGGCACGTTGGCCGTCT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Yap1 (a.k.a. Yap, Yap65, Yki, Yorkie)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Icam 2 SaCas9 YAP sgRNA1 was a gift from Yu Huang (Addgene plasmid # 99734 ; http://n2t.net/addgene:99734 ; RRID:Addgene_99734)
  • For your References section:

    Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Wang L, Luo JY, Li B, Tian XY, Chen LJ, Huang Y, Liu J, Deng D, Lau CW, Wan S, Ai D, Mak KK, Tong KK, Kwan KM, Wang N, Chiu JJ, Zhu Y, Huang Y. Nature. 2016 Dec 7. doi: 10.1038/nature20602. 10.1038/nature20602 PubMed 27926730