pK RagA-RagC(K84T)
(Plasmid
#99708)
-
PurposeBacterial expression of RagA-RagC(K84T)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCOLADuet
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameRagA
-
SpeciesH. sapiens (human)
-
Entrez GeneRRAGA (a.k.a. FIP-1, FIP1, RAGA)
- Promoter T7
-
Tags
/ Fusion Proteins
- His tag (N terminal on backbone)
- Poly Arg (N terminal on backbone)
- SUMO (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GACCCCTGAAGATTTGGACATGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRagC
-
SpeciesH. sapiens (human)
-
MutationK84T
-
Entrez GeneRRAGC (a.k.a. GTR2, RAGC, TIB929)
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TTGTACACGGCCGCATAATCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK RagA-RagC(K84T) was a gift from David Sabatini & Kuang Shen (Addgene plasmid # 99708 ; http://n2t.net/addgene:99708 ; RRID:Addgene_99708) -
For your References section:
Intersubunit Crosstalk in the Rag GTPase Heterodimer Enables mTORC1 to Respond Rapidly to Amino Acid Availability. Shen K, Choe A, Sabatini DM. Mol Cell. 2017 Oct 17. pii: S1097-2765(17)30704-9. doi: 10.1016/j.molcel.2017.09.026. 10.1016/j.molcel.2017.09.026 PubMed 29056322