Skip to main content
Addgene

pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
(Plasmid #99694)

Print
  • Purpose
    Expresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAV
  • Depositing Lab
    George Church
  • Publication
    Vora et al bioRxiv 2018. 298620 ( How to cite )
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99694 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV (pUC f1)
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG)
  • Species
    M. musculus (mouse), Synthetic
  • Mutation
    dead Cas9
  • Entrez Gene
    Actc1 (a.k.a. Actc-1)
  • Tag / Fusion Protein
    • VPR mini (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2 was a gift from George Church (Addgene plasmid # 99694 ; http://n2t.net/addgene:99694 ; RRID:Addgene_99694)

  • For your References section:

    Rational design of a compact CRISPR-Cas9 activator for AAV-mediated delivery. Vora S, Cheng J, Xiao R, VanDusen NJ, Quintino L, Pu WT, Vandenberghe LH, Chavez A, Church G. bioRxiv 2018. 298620 10.1101/298620
Related items:
Commonly requested with: