pETDuet RagA-RagC
(Plasmid #99641)

• Purpose: Bacterial expression of wildtype Rag GTPase dimer
• Depositing Labs: David Sabatini, Kuang Shen
• Publication: Shen et al Mol Cell. 2017 Oct 17. pii: S1097-2765(17)30704-9. doi: 10.1016/j.molcel.2017.09.026.

Backbone

• Vector backbone: pETDuet
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: RagA
• Species: H. sapiens (human)
• Entrez Gene: RRAGA (a.k.a. FIP-1, FIP1, RAGA)
• Promoter: T7
• Tag / Fusion Protein:
  • His tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGATGCGTCCGGCGTAGAGG
• 3′ sequencing primer: CGATTATGCGGCCGTGTACAA

Gene/Insert 2

• Gene/Insert name: RagC
• Species: H. sapiens (human)
• Entrez Gene: RRAGC (a.k.a. GTR2, RAGC, TIB929)
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TTGTACACGGCCGCATAATCG
• 3′ sequencing primer: CAAGACCCGTTTAGAGGCCCCAAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry