Skip to main content
Addgene

pETDuet RagA-RagC
(Plasmid #99641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99641 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETDuet
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    RagA
  • Species
    H. sapiens (human)
  • Entrez Gene
    RRAGA (a.k.a. FIP-1, FIP1, RAGA)
  • Promoter T7
  • Tag / Fusion Protein
    • His tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGATGCGTCCGGCGTAGAGG
  • 3′ sequencing primer CGATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    RagC
  • Species
    H. sapiens (human)
  • Entrez Gene
    RRAGC (a.k.a. GTR2, RAGC, TIB929)
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGTACACGGCCGCATAATCG
  • 3′ sequencing primer CAAGACCCGTTTAGAGGCCCCAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETDuet RagA-RagC was a gift from David Sabatini & Kuang Shen (Addgene plasmid # 99641 ; http://n2t.net/addgene:99641 ; RRID:Addgene_99641)
  • For your References section:

    Intersubunit Crosstalk in the Rag GTPase Heterodimer Enables mTORC1 to Respond Rapidly to Amino Acid Availability. Shen K, Choe A, Sabatini DM. Mol Cell. 2017 Oct 17. pii: S1097-2765(17)30704-9. doi: 10.1016/j.molcel.2017.09.026. 10.1016/j.molcel.2017.09.026 PubMed 29056322