-
Purpose(Empty Backbone) Empty backbone, 3rd generation lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepScalps
- Backbone size (bp) 7740
-
Vector typeMammalian Expression, Lentiviral
- Promoter SFFVp
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- none
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer GCTTCTCGCTTCTGTTCG
- 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScalps_Puro was a gift from Silvia Monticelli (Addgene plasmid # 99636 ; http://n2t.net/addgene:99636 ; RRID:Addgene_99636) -
For your References section:
TET2 Regulates Mast Cell Differentiation and Proliferation through Catalytic and Non-catalytic Activities. Montagner S, Leoni C, Emming S, Della Chiara G, Balestrieri C, Barozzi I, Piccolo V, Togher S, Ko M, Rao A, Natoli G, Monticelli S. Cell Rep. 2016 May 17;15(7):1566-79. doi: 10.1016/j.celrep.2016.04.044. Epub 2016 May 5. 10.1016/j.celrep.2016.04.044 PubMed 27160912