pMK17-01
(Plasmid #99603)

• Purpose: Plasmid containing the parB-m(sf)gfp fusion
• Depositing Labs: Morten Kjos, Jan-Willem Veening
• Publication: van Raaphorst et al Proc Natl Acad Sci U S A. 2017 Jul 3. pii: 201620608. doi: 10.1073/pnas.1620608114.

Backbone

• Vector backbone: pMK17
• Backbone size w/o insert (bp): 8756
• Total vector size (bp): 9538
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: parBp
• Species: Synthetic
• Insert Size (bp): 782
• Promoter: PczcD
• Tag / Fusion Protein:
  • m(sf)gfp (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: CGAGTCTGGTGGTTGGTAAG
• 3′ sequencing primer: CGAAATACGGGCAGACATGG

Resource Information

• Supplemental Documents:
  • pMK17-01 send.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry