Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

plko.1/shMCT4 #474
(Plasmid #99597)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99597 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    plko.1
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCT4
  • gRNA/shRNA sequence
    CCGGCGTCTACATGTACGTGTTCATCTCGAGATGAACACGTACATGTAGACGTTTTTG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_004207
  • Entrez Gene
    SLC16A3 (a.k.a. MCT 3, MCT 4, MCT-3, MCT-4, MCT3, MCT4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plko.1/shMCT4 #474 was a gift from Eli Bar (Addgene plasmid # 99597 ; http://n2t.net/addgene:99597 ; RRID:Addgene_99597)
  • For your References section:

    Inhibition of monocarboxylate transporter-4 depletes stem-like glioblastoma cells and inhibits HIF transcriptional response in a lactate-independent manner. Lim KS, Lim KJ, Price AC, Orr BA, Eberhart CG, Bar EE. Oncogene. 2014 Aug 28;33(35):4433-41. doi: 10.1038/onc.2013.390. Epub 2013 Sep 30. 10.1038/onc.2013.390 PubMed 24077291