Skip to main content
Addgene

TMEM230-M3/Y92C-IRES(isoform 2)
(Plasmid #99567)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99567 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    plRES2-ZsGreen1 Vector (632478)
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TMEM230
  • Alt name
    NM_001009924
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    368
  • Mutation
    M3/Y92C
  • Entrez Gene
    TMEM230 (a.k.a. C20orf30, HSPC274, dJ1116H23.2.1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer ctaggaatgctcgtcaagaagaca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: The mutation numbering for the TMEM230 insert corresponds to the longer isoform.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TMEM230-M3/Y92C-IRES(isoform 2) was a gift from Han-Xiang Deng (Addgene plasmid # 99567 ; http://n2t.net/addgene:99567 ; RRID:Addgene_99567)
  • For your References section:

    Identification of TMEM230 mutations in familial Parkinson's disease. Deng HX, Shi Y, Yang Y, Ahmeti KB, Miller N, Huang C, Cheng L, Zhai H, Deng S, Nuytemans K, Corbett NJ, Kim MJ, Deng H, Tang B, Yang Z, Xu Y, Chan P, Huang B, Gao XP, Song Z, Liu Z, Fecto F, Siddique N, Foroud T, Jankovic J, Ghetti B, Nicholson DA, Krainc D, Melen O, Vance JM, Pericak-Vance MA, Ma YC, Rajput AH, Siddique T. Nat Genet. 2016 Jul;48(7):733-9. doi: 10.1038/ng.3589. Epub 2016 Jun 6. 10.1038/ng.3589 PubMed 27270108