-
PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiGuide ( plasmid #52963)
- Backbone size w/o insert (bp) 9465
- Total vector size (bp) 11391
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameS. pyogenes sgRNA cassette
-
SpeciesSynthetic
-
Insert Size (bp)100
- Promoter hU6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBⅠ (not destroyed)
- 3′ cloning site BsmBⅠ (not destroyed)
- 5′ sequencing primer hU6-F
- 3′ sequencing primer hGata4-rev (5'-ATTGTGGATGAATACTGCC-3') (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHygro-P2A-mTagBFP2
-
Insert Size (bp)1826
- Promoter EF-1a
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byHygro: Addgene plasmid #61426 (Feng Zhang lab) mTagBFP2: Addgene plasmid #34632 (Vladislav Verkhusha lab)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Hygro sequence is from Addgene plasmid #61426 (generously shared by Feng Zhang Lab). "Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.", Konermann et al.. 2014
mTagBFP2 sequence is from Addgene plasmid #34632 (generously shared by Vladislav Verkhusha Lab). "An enhanced monomeric blue fluorescent protein with the high chemical stability of the chromophore. ", Subach et al.. 2014
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiGuide-Hygro-mTagBFP2 was a gift from Kristen Brennand (Addgene plasmid # 99374 ; http://n2t.net/addgene:99374 ; RRID:Addgene_99374) -
For your References section:
Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I, Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 10.1016/j.stemcr.2017.06.012 PubMed 28757163